1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
2 years ago
14

The following segment of DNA encodes for a short polypeptide. Note that DNA triplets encoding for the start codon (AUG) and a st

op codon are included in this sequence. What is the polypeptide sequence encoded by this gene?
5’…CCCAGCCTAGCCTTTGCAAGAGGCCATATCGAC…3’
3’…GGGTCGGATCGGAAACGTTCTCCGGTATAGCTG…5’
a) Met-Gly-Arg-Gly-Phe-Ala
b) Met-Ala-Ser-Cys-Lys-Gly
c) Met-Ala-Ser-Cys-Lys-Gly-Ile
d) Met-Gly-Arg-Gly-Phe-Ala-Ile
Biology
1 answer:
miskamm [114]2 years ago
3 0

Answer:

So none of the option is correct.

Explanation:

As we know the transcription occurs in 5' to 3' direction so 3'-5' work as a template strand for the transcription and the mRNA formed will be :-

5' CCC AGC CUA GCC UUU GCA AGA GGC CAU AUC GAC 3'

Here there is no start codon( AUG) for translation.

So none of the option is correct.

There might be error in the nucleotide sequence.

CCC- pro

AGC - ser

CUA- leu

GCC- ala

UUU- phe

GCA- ala

AGA- arg

GGC- gly

CAU- his

AUC- lle

GAC- asp

You might be interested in
Infer the relationship of temperature and concentration of reactants with the rate of reaction.​
denis23 [38]

Answer:When we increase the temperature of one of the reactants in a chemical reaction, this increases the particles kinetic energy, making them move much faster than they were before. This also increases the chance of a more successful collision and the rate of reaction.

Explanation:

4 0
2 years ago
A naturally occurring, inorganic solid that has a crystal structure & a definite chemical composition.
Snezhnost [94]

Mineral is a naturally occurring, inorganic solid that has a crystal structure & a definite chemical composition.

3 0
2 years ago
The greatest ocean depths found anywhere occur in ocean trenches. True or False?
vodka [1.7K]
The answer to the question is true
5 0
3 years ago
Jordon had surgery to repair her outer ear. What is the medical term for this surgery?
Mars2501 [29]
Ossiculoplasty is the term to repair the outer ear.
7 0
3 years ago
Read 2 more answers
someone has their blood tested and finds that their blood sugar level is 138. this is equivalent to 1.38%. How much glucose is i
disa [49]

The amount of glucose in each ml of their blood will be 0.00138 g.

<h3>Blood glucose concentration</h3>

The concentration of glucose in the person's blood is 1.38%.

This means that there is 1.38 g of sugar per Liter of blood.

1 Liter of blood contains 1.38 g of glucose, and there is 1000 mL in 1 Liter of blood.

1000 mL contains 1.38 g

1 ml contains = 1.38 x 1 / 1000 = 0.00138 g

This means 0.00138 g of glucose will be present in every 1 mL of the person's blood.

More on blood glucose can be found here: brainly.com/question/8394646

#SPJ1

3 0
2 years ago
Other questions:
  • Which type of substance cannot be separated physically
    7·2 answers
  • An energy pyramid shows the amount of available at each feeding level in an ecosystem.​
    5·1 answer
  • 2. In an atom with the same number of electrons and protons, the electrical
    11·1 answer
  • At the end of meiosis, the daughter cells have ______ number of chromosomes as the parent cell.
    14·1 answer
  • The electron transport chain is composed of adjacent electron carriers in the inner mitochondrial membrane. It generates energy
    7·1 answer
  • Where does light first enter the eye
    5·2 answers
  • A resting axon's fluid interior has a mostly negative charge thanks to the presence of large ________ ions.
    11·1 answer
  • Some viruses have RNA in place of DNA? TRUE FALSE
    6·2 answers
  • Can help me this is question
    6·2 answers
  • What are cilia and why are they important in the respiratory system?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!