1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
3 years ago
14

The following segment of DNA encodes for a short polypeptide. Note that DNA triplets encoding for the start codon (AUG) and a st

op codon are included in this sequence. What is the polypeptide sequence encoded by this gene?
5’…CCCAGCCTAGCCTTTGCAAGAGGCCATATCGAC…3’
3’…GGGTCGGATCGGAAACGTTCTCCGGTATAGCTG…5’
a) Met-Gly-Arg-Gly-Phe-Ala
b) Met-Ala-Ser-Cys-Lys-Gly
c) Met-Ala-Ser-Cys-Lys-Gly-Ile
d) Met-Gly-Arg-Gly-Phe-Ala-Ile
Biology
1 answer:
miskamm [114]3 years ago
3 0

Answer:

So none of the option is correct.

Explanation:

As we know the transcription occurs in 5' to 3' direction so 3'-5' work as a template strand for the transcription and the mRNA formed will be :-

5' CCC AGC CUA GCC UUU GCA AGA GGC CAU AUC GAC 3'

Here there is no start codon( AUG) for translation.

So none of the option is correct.

There might be error in the nucleotide sequence.

CCC- pro

AGC - ser

CUA- leu

GCC- ala

UUU- phe

GCA- ala

AGA- arg

GGC- gly

CAU- his

AUC- lle

GAC- asp

You might be interested in
Explain why the use of the term “theory” in science is different from the use of the word “theory” in everyday language.
kari74 [83]

Answer:

In everyday language a theory means a hunch or speculation. Not so in science. In science, the word theory refers to a comprehensive explanation of an important feature of nature supported by facts gathered over time. Theories also allow scientists to make predictions about as yet unobserved phenomena".

Explanation:

4 0
3 years ago
Arrange the statement of events below in the order that best describes the sequence of events in the pathology of clostridium pe
Varvara68 [4.7K]

C. perfringens is found greatly in the environment in soil, rotting greenery and marine sediment, as well as in the intestinal tract of creatures. The bacteria can create endospores, apt of surviving adverse conditions for long periods of time.

<h3>What type of food poisoning is Clostridium perfringens?</h3>

Clostridium perfringens food poisoning is critical gastroenteritis induced by ingestion of contaminated food. Signs are watery diarrhea and abdominal cramps. Diagnosis is by identifying C. perfringens in infected food or in stool.

Thus, Clostridium perfringens food poisoning is critical gastroenteritis caused by ingestion of contaminated food.

To learn more about  Clostridium perfringens click here:

brainly.com/question/15006110

#SPJ1

8 0
2 years ago
Soil color is classified by _______.
dmitriy555 [2]
D: using a color reference chart :)
8 0
3 years ago
Read 2 more answers
How is data used to evaluate outcomes? Provide an example as it relates to an area of nursing.
Zielflug [23.3K]

Answer:

Data is used to evaluate the treatment that is provided to the patient in each episode of nursing diagnosis.

Explanation:

An outcome measure is a tool that is used to assess the current status of the patient that is influenced by the nursing interventions. It is marked by the status of the resolution for individual nursing diagnosis as being either resolved or not.

The data collected by outcome measures supports in establishing the foundation for providing the correct medical treatment to the patient. Which later helps to assess the treatment provided to the patient. It provides reliable and credible justification for the treatment on an individual patient level.

Below are a few examples of these outcome measures;

  • Mortality
  • Timeliness of care
  • Safety of care
  • Patient Experience
  • Effectiveness of care
8 0
3 years ago
A jar contains 26 fluid ouncesbof spaghetti sauce. How many cups of spaghetti sauce do 4 jars contain
JulijaS [17]

____________________________________________________

Answer:

Your answer would be 13 cups of spaghetti sauce.

____________________________________________________

Explanation:

Lets break down this question to make the answer easier:

8 ounces = 1 cup

We are going to use the above to help us solve this question.

In your question, you have 26 ounces, and you would have four cups. You would need to calculate how many ounces are in the 4 cups

To do this, you would multiply 26 by 4:

26 × 4 = 104

The four cups have a total of 104 for ounces. But, you are not done solving yet. You need to found how many cups there are. We would be going to use the 8 ounces, since we know that is the amount of one cup, and use that to divide 104, since we need to distribute the amount of ounces to the cups.

You would divide 104 by 8

104 ÷ 8 = 13

There would be 13 cups of spaghetti sauce in 4 jars of spaghetti sauce that has 26 ounches in it.

Your FINAL answer would be 13.

____________________________________________________

<em>-Julie</em>

8 0
3 years ago
Other questions:
  • A box of jello has a mass of 250g. how many boxes must be bought to have 1kg of jello?
    8·1 answer
  • Which o the following is true about cellular resporation
    15·1 answer
  • Porque el huevo es una celula
    8·1 answer
  • Some ciliates have thick bundles of cilia for "walking" or as supportive structures. these structures are called _______.
    15·1 answer
  • The brain component responsible for analyzing sensory information and our ability to think, talk, and reason is called the _____
    8·1 answer
  • Which of the following is not a state of matter?
    11·1 answer
  • Overexertion in extremely hot temperatures helps the body to cool itself. true false
    11·2 answers
  • What type of reaction is photosynthesis
    9·1 answer
  • Mind Buster. Think before giving an answer. <br>c)Foods rich in vitamin c should be eaten raw.​
    5·1 answer
  • What is not a characteristic of a pioneer species
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!