1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
3 years ago
14

The following segment of DNA encodes for a short polypeptide. Note that DNA triplets encoding for the start codon (AUG) and a st

op codon are included in this sequence. What is the polypeptide sequence encoded by this gene?
5’…CCCAGCCTAGCCTTTGCAAGAGGCCATATCGAC…3’
3’…GGGTCGGATCGGAAACGTTCTCCGGTATAGCTG…5’
a) Met-Gly-Arg-Gly-Phe-Ala
b) Met-Ala-Ser-Cys-Lys-Gly
c) Met-Ala-Ser-Cys-Lys-Gly-Ile
d) Met-Gly-Arg-Gly-Phe-Ala-Ile
Biology
1 answer:
miskamm [114]3 years ago
3 0

Answer:

So none of the option is correct.

Explanation:

As we know the transcription occurs in 5' to 3' direction so 3'-5' work as a template strand for the transcription and the mRNA formed will be :-

5' CCC AGC CUA GCC UUU GCA AGA GGC CAU AUC GAC 3'

Here there is no start codon( AUG) for translation.

So none of the option is correct.

There might be error in the nucleotide sequence.

CCC- pro

AGC - ser

CUA- leu

GCC- ala

UUU- phe

GCA- ala

AGA- arg

GGC- gly

CAU- his

AUC- lle

GAC- asp

You might be interested in
Muscle contraction is an example of which of the following types of work? Group of answer choices electrical concentration heat
Citrus2011 [14]

Answer:

Muscle contraction is an example of mechanical contraction.

Explanation:

Muscular contraction is the activation of generating tension which appear in the muscle fiber as it does't change the length of muscle and is followed by muscular relaxation.

Muscle contraction is based on force and length.

The process of skeletal muscle contraction is an energy requiring process.

In order to perform mechanical work,actin and myosin  utilizes the chemical energy into ATP that ultimately require during muscle contraction and relaxation.

In a working muscle,glucose is released  from glycogen that are stored in the muscle by the process of glycolysis in which glucose broken down into ATP that is required by cells and tissues.

3 0
3 years ago
You have isolated a microorganism from seawater that contains thylakoid membranes, gas vacuoles, and carboxysomes. It is most li
Nata [24]

Answer:

D. A cyanobacterium

Explanation:

Cyanobacteria have gas vacuoles, thykaloid membranes and carboxysomes

6 0
3 years ago
What occurs during a decomposition reaction?
blondinia [14]
During a decomposition reaction, a compound partitions into its components.
8 0
3 years ago
Which of the following sequence shows the correct order from the smallest to the largest?
Tatiana [17]

Answer:

Nucleotide, Gene, DNA, Chromosome, Cell.

Explanation:

3 0
2 years ago
Do you think the discoveries your class made would help predict and explain patterns of change in the size of populations for ot
beks73 [17]

Yes they would help predict and explain patterns of change in the size of populations for other large consumers.

<h3>What is Population?</h3>

This is defined as the total number of organisms in an area over a given period of time.

The population of producers and primary consumers help predict that of larger consumers. The higher their population, the lesser the population of large consumers that live in the Serengeti ecosystem.

Read more about Population here brainly.com/question/13403673

#SPJ1

4 0
2 years ago
Other questions:
  • The diffusion of water through a selectively permeable membrane is called__. 19. the process that moves materials through a memb
    13·1 answer
  • What moves to opposite poles in Anaphase 1
    13·1 answer
  • Where does translation take place? hints where does translation take place? endoplasmic reticulum golgi apparatus ribosome nucle
    10·1 answer
  • Restless tectonic plates move (shift) between one and 15 cm per
    7·1 answer
  • What temperature resulted in the most active yeast?<br> A)<br> 4°C<br> 15°C<br> 22°C<br> 36°C
    7·2 answers
  • A brown bird was crossed with a white one and all of the offspring were tan. Complete a Punnett Square analysis for this pair to
    7·1 answer
  • What type of molecule is represented by the model below?
    8·1 answer
  • Based on the diagram which statement describes sexual reproduction?
    10·1 answer
  • A pioneer species is...
    7·1 answer
  • NEED ASAP. Which of the following increases the chance of survival in a changing environment?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!