1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
3 years ago
14

The following segment of DNA encodes for a short polypeptide. Note that DNA triplets encoding for the start codon (AUG) and a st

op codon are included in this sequence. What is the polypeptide sequence encoded by this gene?
5’…CCCAGCCTAGCCTTTGCAAGAGGCCATATCGAC…3’
3’…GGGTCGGATCGGAAACGTTCTCCGGTATAGCTG…5’
a) Met-Gly-Arg-Gly-Phe-Ala
b) Met-Ala-Ser-Cys-Lys-Gly
c) Met-Ala-Ser-Cys-Lys-Gly-Ile
d) Met-Gly-Arg-Gly-Phe-Ala-Ile
Biology
1 answer:
miskamm [114]3 years ago
3 0

Answer:

So none of the option is correct.

Explanation:

As we know the transcription occurs in 5' to 3' direction so 3'-5' work as a template strand for the transcription and the mRNA formed will be :-

5' CCC AGC CUA GCC UUU GCA AGA GGC CAU AUC GAC 3'

Here there is no start codon( AUG) for translation.

So none of the option is correct.

There might be error in the nucleotide sequence.

CCC- pro

AGC - ser

CUA- leu

GCC- ala

UUU- phe

GCA- ala

AGA- arg

GGC- gly

CAU- his

AUC- lle

GAC- asp

You might be interested in
The rain forests of the world trap a large amount of carbon dioxide, a greenhouse gas. Every year, however, more rain forest is
IrinaVladis [17]

Carbondioxide, being a green house gas has the property of trapping the heat from the sunlight and thus increasing the temperature of the place. As more and more rain forests are cut down and burned, there is an increase in this green house gas in the atmosphere thus leading to a steady increase in the temperatures.

As we look at the graphs that are given, we can see that the graph C shows the steady increase in the temperature as the time passes. Hence option C is the right answer

7 0
3 years ago
Read 2 more answers
in the lab the term “phase change” refers to a change of boiling point a change of freezing point a change of flash point a chan
elena-14-01-66 [18.8K]
It refers to a change of  state.
7 0
3 years ago
The graph below shows the distance traveled by four cars, A, B, C, and D, over a period of time.
kumpel [21]
(B) All cars traveled at different speeds. Sorry if im wrong
7 0
3 years ago
which is an example of an acquired trait? A the ability to hear B the ability to write C color vision D body hair
makkiz [27]
B . ability to write
5 0
3 years ago
Read 2 more answers
What is the make-up (structure) of the plasma membrane? what makes the plasma membrane selectively permeable? how are the phosph
devlian [24]
Lipid bilayer model was proposed for its structure but it was modified and new structure is according to fluid mosaic model. Plasma membrane is selectively permible as it selects small molecules like lipid etc (composition is also of lipid and as solubility principle like dissolve like) so large and charged molecules like plasma and ion can't pass through it. Lipid are in form of layer so at the chain when ever other phosphate group attach the place conjugate molecule (phospholipid ) formed
3 0
3 years ago
Other questions:
  • Living, and some non-living, entities that cause disease are called __________. See Section 9.1 (Page 191) View Available Hint(s
    10·1 answer
  • What type of reactions build proteins from amino acids??????????
    9·1 answer
  • Speculate on how higher sea-surface temperatures (sst) might impact earth's greenhouse effect.
    10·1 answer
  • What tree whose colonies makeup the largest organisms on earth
    7·1 answer
  • Which of the following is a step that occurs within an inflammatory response?
    6·1 answer
  • Pepsin, an enzyme that is found in the stomach of humans, functions in breaking down proteins. It is denatured as it travels to
    12·1 answer
  • The shape of a dna molecule is best described as an
    6·2 answers
  • What is the source of energy for evaporation in the water cycle?
    6·1 answer
  • The events in the ovarian and uterine cycles are largely controlled by the pituitary gonadotropins and ovarian hormones. Before
    5·1 answer
  • А<br> is an environment in which an organism's needs are met.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!