1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
2 years ago
14

The following segment of DNA encodes for a short polypeptide. Note that DNA triplets encoding for the start codon (AUG) and a st

op codon are included in this sequence. What is the polypeptide sequence encoded by this gene?
5’…CCCAGCCTAGCCTTTGCAAGAGGCCATATCGAC…3’
3’…GGGTCGGATCGGAAACGTTCTCCGGTATAGCTG…5’
a) Met-Gly-Arg-Gly-Phe-Ala
b) Met-Ala-Ser-Cys-Lys-Gly
c) Met-Ala-Ser-Cys-Lys-Gly-Ile
d) Met-Gly-Arg-Gly-Phe-Ala-Ile
Biology
1 answer:
miskamm [114]2 years ago
3 0

Answer:

So none of the option is correct.

Explanation:

As we know the transcription occurs in 5' to 3' direction so 3'-5' work as a template strand for the transcription and the mRNA formed will be :-

5' CCC AGC CUA GCC UUU GCA AGA GGC CAU AUC GAC 3'

Here there is no start codon( AUG) for translation.

So none of the option is correct.

There might be error in the nucleotide sequence.

CCC- pro

AGC - ser

CUA- leu

GCC- ala

UUU- phe

GCA- ala

AGA- arg

GGC- gly

CAU- his

AUC- lle

GAC- asp

You might be interested in
You are told that an atom has 10 electrons how many protons does it contain
Alex_Xolod [135]
No of electrons is equal to no of protons so it will have 10 protons
7 0
3 years ago
Describe the three types of environments found solutions
alexandr1967 [171]
<span>I think you might be asking about the 3 different osmotic conditions a cell might find itself in.  Isotonic is the normal cell environment where water moves in and out of the cell freely and equally in both directions.  It is in osmotic equilibrium so to speak.  The concentration of water and solutes is equal on both sides of the cello membrane.  In a hypotonic solution the cell will gain water and swell up -...</span>
3 0
3 years ago
Once nutrients have been broken down through the process of cellular respiration, which of the following must also happen in ord
irina [24]
I think the answer is B:the cell must remove waste
Explain: it’s definitely not option 1, it’s an animal cell. The last one I doubt as well. So it is down to B and C.
3 0
2 years ago
After 3 half lives how much of a radioactive substance will remain<br> 1/16<br> 1/4<br> 1/2<br> 1/8
anyanavicka [17]
1/2 of a radioactive substance will remain after 3 half lives.
4 0
2 years ago
The integumentary system is an example of _____.
Fittoniya [83]

Hair, skin, glands, nerves, and nails. And also it’s main function is to act as a barrier to protect the body from the outside world.

8 0
3 years ago
Read 2 more answers
Other questions:
  • As líquid water freezes, the molecules take up more space than aqua water What do you think would happen if frozen water molecul
    10·1 answer
  • Lactic acid buildup during respiration is the result of____
    14·1 answer
  • On early Earth, what was referred to as the "primordial soup"?
    8·1 answer
  • The diagrams below show a cross-section of an environment in which there are no earthworms present and a cross-section of an env
    9·1 answer
  • Over the years, the forest cover in a particular ecosystem was reduced from about 50% to 20%. What would be the MOST LIKELY effe
    5·2 answers
  • Where does the process of Transcription take place?
    9·2 answers
  • When the motion energy of an object changes there is inevitably some other change in energy at the same time. If an object is sl
    11·1 answer
  • Describe what would happen to the consumers and producers within the ecosystem if the bacteria were wiped out or removed?
    8·2 answers
  • Plz help this is past due
    6·2 answers
  • #9<br> The ___________________ system is the body's garbage service.
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!