1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
3 years ago
14

The following segment of DNA encodes for a short polypeptide. Note that DNA triplets encoding for the start codon (AUG) and a st

op codon are included in this sequence. What is the polypeptide sequence encoded by this gene?
5’…CCCAGCCTAGCCTTTGCAAGAGGCCATATCGAC…3’
3’…GGGTCGGATCGGAAACGTTCTCCGGTATAGCTG…5’
a) Met-Gly-Arg-Gly-Phe-Ala
b) Met-Ala-Ser-Cys-Lys-Gly
c) Met-Ala-Ser-Cys-Lys-Gly-Ile
d) Met-Gly-Arg-Gly-Phe-Ala-Ile
Biology
1 answer:
miskamm [114]3 years ago
3 0

Answer:

So none of the option is correct.

Explanation:

As we know the transcription occurs in 5' to 3' direction so 3'-5' work as a template strand for the transcription and the mRNA formed will be :-

5' CCC AGC CUA GCC UUU GCA AGA GGC CAU AUC GAC 3'

Here there is no start codon( AUG) for translation.

So none of the option is correct.

There might be error in the nucleotide sequence.

CCC- pro

AGC - ser

CUA- leu

GCC- ala

UUU- phe

GCA- ala

AGA- arg

GGC- gly

CAU- his

AUC- lle

GAC- asp

You might be interested in
Is the general term for a grouping of organisms
olga nikolaevna [1]

Answer:

Classification of Living things

Explanation:

8 0
3 years ago
critically evaluate the role of a persons rights and responsibilities when executing freedom of expression during verbal interpe
Stells [14]

A person does have basic human rights and one is the freedom of expression. Though this is the case, we should understand that our right to freely express ourselves (from political to religious views), it does not necessarily give us the right to impede another person’s. A play with words can easily hurt or even harass other people, and in return may be a form of human right violation. 

3 0
3 years ago
Discuss ecological pyramids, use tropic levels to discuss this process of heat loss.
Dima020 [189]

Answer:

Energy pyramids is representation of food chain where producers lie at the base of pyramid followed by primary, secondary and tertiary consumer. A tertiary consumer lies at the top of the energy pyramid .

Explanation:

An ecological pyramid is a chronological arrangement of organism in which the organism producing the food lies at the base of pyramid and remaining all organism lie above it.

Each level of an ecological pyramid is called a trophic level and an organism lying at any trophic level feed upon organism lying in trophic level prior to it.

Energy transferred to an organism lying at certain trophic level is 10% of the energy contained in an organism lying at its lower trophic level. remaining 90% of the energy is used by an organism for its internal metabolic process.

8 0
3 years ago
What does it mean when they say genetic.
olya-2409 [2.1K]

Answer:

relating to or determined by the origin, development, or causal antecedents of something

Explanation:

3 0
3 years ago
Read 2 more answers
What is it called when a molecule moves across a semipermeable membrane into a region of higher concentration?
Daniel [21]
Its actaully active transport
4 0
3 years ago
Read 2 more answers
Other questions:
  • Plants and animals do not respond to the pressure of abiotic factors in their ecosystems
    14·2 answers
  • A marine scientist concluded that the Canary Islands were not formed by volcanic activity because his data showed that the fault
    7·2 answers
  • What is the internal environment and explain how it is related to the inside of a cell, the interstitial fluid and to the outsid
    10·1 answer
  • in pinus sp. male cone matured earlier than female cone . describe how this species the success of pollination​
    12·1 answer
  • When a Venus flytrap catches an insect, it is reacting to the stimulus of
    12·2 answers
  • Protecting endangered animals is a different process because
    5·1 answer
  • Why is the area around the equator considered the warmest part of the Earth?
    8·1 answer
  • How does homeostasis maintain a balance in an ecosystem?
    6·1 answer
  • Nitrogen waste is the byproduct of _______ metabolism
    8·2 answers
  • What impact do you hope to have on the world and how will STEM play a role in making that impact, Essay pls help need ASAPPPP WI
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!