1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saveliy_v [14]
3 years ago
14

The following segment of DNA encodes for a short polypeptide. Note that DNA triplets encoding for the start codon (AUG) and a st

op codon are included in this sequence. What is the polypeptide sequence encoded by this gene?
5’…CCCAGCCTAGCCTTTGCAAGAGGCCATATCGAC…3’
3’…GGGTCGGATCGGAAACGTTCTCCGGTATAGCTG…5’
a) Met-Gly-Arg-Gly-Phe-Ala
b) Met-Ala-Ser-Cys-Lys-Gly
c) Met-Ala-Ser-Cys-Lys-Gly-Ile
d) Met-Gly-Arg-Gly-Phe-Ala-Ile
Biology
1 answer:
miskamm [114]3 years ago
3 0

Answer:

So none of the option is correct.

Explanation:

As we know the transcription occurs in 5' to 3' direction so 3'-5' work as a template strand for the transcription and the mRNA formed will be :-

5' CCC AGC CUA GCC UUU GCA AGA GGC CAU AUC GAC 3'

Here there is no start codon( AUG) for translation.

So none of the option is correct.

There might be error in the nucleotide sequence.

CCC- pro

AGC - ser

CUA- leu

GCC- ala

UUU- phe

GCA- ala

AGA- arg

GGC- gly

CAU- his

AUC- lle

GAC- asp

You might be interested in
1. What type of succession takes place that increases the biological diversity of an ecosystem? For example, if we started with
professor190 [17]

There are two types of succession that lead to the increasment of the ecosystem:

1. Primary succession is the change in the structure of an ecosystem represented with the increase of the ecological community on an area that has not been previously occupied by an ecological community such as area after the lava flow or glacial lake. The first organisms of primary succession are pioneer plants usually, lichens and mosses.

2. Secondary succession includes the step of removal of pre-existing community and after that, colonization of the new one.  


6 0
3 years ago
Compared to the time he spent in other parts of South America, Darwin spent little time collecting specimens in the Galapagos.
Feliz [49]

The correct answer is True

7 0
3 years ago
Read 2 more answers
BRAINLIEST!! Would the mass of the light bulb change as it travels from Earth to the Moon. Why or why not? please explain in a c
Shtirlitz [24]

Answer:

The light bulb will have the same mass on the moon as it will on earth. The mass of an object will not change if the gravitational pull on the object changes, but the weight of the object will. For instance, if you measure your mass on Earth and then measure your mass on the moon, your mass will remain the same. The same theory applies to any object with mass.

Explanation:

hope it helps brainliest pls!! :)

6 0
3 years ago
Read 2 more answers
Explain how the data from the river samples showed that there was a problem with the water treatment plant.
Agata [3.3K]

Answer:

The water treatment plant does not work properly.

Explanation:

The data from the river samples showed that there was a problem with the water treatment plant because there is high amount of pollutants are present in the river sample. The presence of pollutants in the samples shows that the water treatment plant did not work properly, if they did no pollutants are present in the river water so this presence of pollutants indicates inefficiency of water treatment plant.

5 0
3 years ago
How does in vitro fertilization work?
babymother [125]
There are many forms of VIF and each forms are made for different purposes. basically, you just extract a female egg and a sample of the male sperm, bad sperm can be separated via by adding specific chemicals. The sperm will then be transferred into the egg and the egg is transferred into the women. (This is ICSI) There are other forms under the category of IVF but this is one of the example. (ICSI only deals with male infertility)
6 0
3 years ago
Read 2 more answers
Other questions:
  • What scientist dose to which ??
    14·2 answers
  • Why does the bottom of the food chain have the most energy
    9·2 answers
  • Which question is most clearly related to the field of biology?
    5·2 answers
  • Carbon dioxide enters the atmosphere by animal and human ___ and the burning of ____.
    6·1 answer
  • Why is there a larger biodiversity hot spot in New Zealand than Australia.migration of both animals and plants from Australia b.
    12·2 answers
  • The heat absorbed/added to the material causes the material to change its form from?
    9·1 answer
  • Why did scientists want to learn more about how the Bajau people hold their
    8·1 answer
  • B. Will using farmland to grow crops for ethanol cause food shortages and increase<br> food prices?
    13·1 answer
  • Which animal is one of only two mammals that lay eggs?
    6·1 answer
  • Pls help again, brainlist!!!!!!!!!!!!!!!!!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!