Answer:
A. converting chemical energy into a food.
This process is known as phosphorylation. Glucose can be converted into Glucose-6-phosphate by the addition of the phosphate group from ATP. ATP serves as the biological energy company, releasing energy for both anabolic and catabolic processes and being recharged by energy generated from other catabolic reactions.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The answer is C i loooked it up
ADP (adenosine diphosphate)
A diet that consist highly of fruits with lots of vitamin c and vegetables along with coconut water and pomegranate juice can help maintain body heat and not lead to it over heating and of course lots of cold water. Milk with a bit of honey could also help.
