2 years ago

In the water culture experiment why should a lack of nitrate cause reduced growth

1 answer:

3 0

Answer:

Plants absorb nitrates in water through their roots. Nitrates are present in high levels in plant fertilisers. Without nitrates, the amount of chlorophyll in leaves reduces. ... This reduces the plant's ability to photosynthesise and grow properly, which reduces the farmers' crop yield .

You might be interested in

Question 1 (2 points) BIOLOGY HELP PLEASEEEEEE! Scientists are conducting an experiment on a new specimen. They are trying to de

Nitella [24]

Answer:

Biuret Reagent
Water is the only substance that would react with all of the indicators.

Explanation:

8 0

3 years ago

The ________ of the myelin sheath insulates neurons so messages are conducted more efficiently.

Delicious77 [7]

Answer :

The<u> fat </u>of the myelin sheath insulates neurons so messages are conducted more efficiently.

3 0

4 years ago

Read 2 more answers

What is one drawback to relying on wind power for energy?

Pachacha [2.7K]

<span>The answer is D. Most often, winds do not blow with a consistent velocity all year

Wind power is clean energy the only problem is that it is never consistent enough to fully sustain everyone's energy needs.</span>

6 0

4 years ago

Read 2 more answers

Help I'm confused!

aev [14]

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

7 0