<span>The organic molecules that must be included in the soil for earthworm nutrition are Neutral pH. A neutral pH substance that is neither basic nor acidic is considered neutral. The pH scale is the one that measures how a substance is basic or acidic. It ranges from 0-14. A 7 pH is neutral.</span>
The transcription process occurs in three stages:
initiation, chain elongation, and termination.
Transcription is the process in which the information in a strand of DNA is copied into a new molecule of messenger RNA.
hope that helps :)
Answer:
other answer is right but they got the letter wrong, its answer B: Birth defects
Explanation:
This information can be useful to agriculture because bees are major pollinators of crops, so it is important to know which pesticides to manage in order to avoid risk to bee survival. That is option B.
Bees are one of the social insects that lives in societies that are based on a caste system.
Each caste performs a special task or series of tasks that serves as an economic importance to the agricultural system.
Pests such as parasitic mites cause poor agricultural yield. By using pesticides, which are protective chemicals, farmers have greatly improved crop yield.
The bee workers while in search of pollen from crops can be harmed from the pesticides that is being used to control parasitic mites. This can lead to Colony collapse disorder of the caste system of bees.
Therefore, it is important to know which pesticides to manage in order to avoid risk to bee survival.
Learn more here:
brainly.com/question/22575738
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
