1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Svetradugi [14.3K]
1 year ago
7

When comparing two species, which type of body structure indicates evolutionary relatedness?.

Biology
1 answer:
vaieri [72.5K]1 year ago
4 0

Homologous structure is type of body structure that indicates evolutionary relatedness.

<h3>What is Homologous structures?</h3>

Homologous structures refers to body structures like organ or bone that have similar underlying anatomical features that exist in different animals. These structures entails that different animals descend from a common ancestor and serve as evidence of evolution.

Learn more about homologous structures here.

brainly.com/question/7904813

You might be interested in
How can zoning laws be beneficial to a city’s residents? a. They prevent new business development. b. They can prevent new devel
Vadim26 [7]

The right option is; b. They can prevent new development that would harm established residents.

Zoning laws are laws that are created to specify the areas in which commercial, residential, industrial, or recreational activities may occur. Zoning involves grouping land in a town into zones in which certain land uses are prohibited or allowed. Through zoning, the governments regulate the physical development of land and buildings, and restrict how people can use their properties.

8 0
3 years ago
Read 2 more answers
In an experiment, the variables that are kept the same between the experimental group and the control group are called ________.
nekit [7.7K]

Answer:

B. Constants

Explanation:

Constants are the factors that stay the same throughout the entire experiment no matter which group. The definition of a constant is "a situation or state of affairs that does not change." this furthers the point that constant is the correct answer because they don't change in the experiment.

5 0
2 years ago
Read 2 more answers
How about this who knows this
Dvinal [7]

Answer:

yep it should be sweating

im sure now

5 0
3 years ago
Read 2 more answers
Which is not a function of antibodies? neutralize antigen. agglutinate or precipitate antigen. activate complement enhance phago
siniylev [52]
All of above choices are functions of antibodies
8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • True or False? Meiosis produces four nonidentical cells, each containing neither homologous chromosomes nor sister chromatids.
    9·2 answers
  • What type of cell death is likely to occur if there is a failure of regulation of the cell cycle?
    9·1 answer
  • I need help with punnet squares
    10·2 answers
  • Describe how a hidden virus multiplies
    15·1 answer
  • _____ is thermal energy that flows between objects due to a difference in temperture.
    6·2 answers
  • Question 5 (Multiple Choice Worth 2 points)
    6·2 answers
  • Which statement correctly shows the flow of energy in a food chain?
    8·1 answer
  • Which of the following substances is neutral?
    12·1 answer
  • I'll give brainiest if correct
    15·2 answers
  • As an individual ages, new neurons and dendrites appear, but others atrophy. Compared to when they were adolescents, adults have
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!