1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kitty [74]
1 year ago
11

In the embryo, the early skeletal muscle originates from the _______. In the adult, skeletal muscle is repaired by fusion of ___

____ with muscle fibers. Fill in the blanks.
Biology
1 answer:
const2013 [10]1 year ago
7 0

The prenatal muscle originates from the myotome. The myotome produces presumed myoblasts that form the satellite cells. Answer: myotome / satellite cells.

<h3>How is the skeletal muscle originated and repaired?</h3>

Myogenesis is the process of skeletal muscle formation during the embryonal stage. Structures derived from the mesodermal produce the firsts muscle fibers of the body, and then other additional fibers.

The myotome is a primitive muscular structure that contains progenitor muscle cells. Embryonary myotome cells produce two types of cells,

  • presumed myoblasts that constitute a store of cells that can multiplicate through mitosis

  • properly said myoblasts that can not suffer mitosis

Some of the presumed myoblasts can differentiate into other cells, and some others remain undifferentiated, turning into satellite cells.

This is, progenitor cells in the myotome originate presumed myoblasts, and then these last ones produce satellite cells located in the postnatal skeletal muscle.

Satellite cells are involved in the postnatal process of muscle repair. They suffer successive mitosis producing new myoblasts and more satellite cells.

  • In the embryo, the early skeletal muscle originates from the  <u>myotome.</u>
  • In the adult, skeletal muscle is repaired by fusion of _<u>Satellite cells</u>_ with muscle fibers.

You can elarn more about the muscle formation and repair at

brainly.com/question/5768909

brainly.com/question/9324960

You might be interested in
What is the purpose of the G1 and G2 phases?
wel

Answer:

Explanation:The G1 and G2 phases are times of growth and preparation for major changes. The synthesis phase is when the cell duplicates the DNA in its entire genome. The three phases of interphase also allow for checkpoints to ensure that things are working properly.

3 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
When living things use chemical reactions to break down food, some of the energy is transformed into
Nesterboy [21]
Calories for heat, exercise, etc
6 0
3 years ago
Read 2 more answers
Why do phospholipids form a bilayer in water
Gre4nikov [31]
Phospholipids will form a bilayer in water because they contain hydrophobic (Water fearing.. in this cause water "hating") tails and hydrophilic heads (water loving). So they form a bilayer to remove the tails from water likewise, this satisfies the hydrophilic heads because they are still exposed to water.
8 0
2 years ago
Which of the following is a type of tissue in plants that is dead at maturity?
victus00 [196]

Answer:

The correct answer will be option-B.

Explanation:

The plant tissues are composed of three types of cells: parenchyma, collenchyma and sclerenchyma.

The parenchyma and collenchyma remain alive at their maturity but sclerenchyma loses their protoplasm and become dead. These cells deposit lignin in their secondary walls and form hard tissues of the plant-like hard shell of a coconut. Sclerenchyma provides mechanical strength to the plant.

Thus, Option-B is the correct answer.

3 0
2 years ago
Other questions:
  • Russ went for a run, and Nelly took a nap. They then watched a horror movie together. Usually, Russ and Nelly are about equally
    12·1 answer
  • What will a hypothesis become if it is supported by repeated experimentation? A. A control B. A scientific theory C. A predictio
    13·2 answers
  • All the offspring of a cross between a RED-flowered plant and a WHITE-flowered plant have PINK flowers (blending of traits/inter
    11·1 answer
  • Biologists estimate how long ago species separated from a common ancestor using a technique called
    7·2 answers
  • A remora is a type of fish with a unique suction cup on the underside of its body. It can often be found swimming next to or att
    8·1 answer
  • What is the answer to this?
    9·1 answer
  • Striking the "funny bone" is actually stimulation of (or injury to) the ________. Striking the "funny bone" is actually stimulat
    8·1 answer
  • What type of agriculture is most characteristic of a third-world developing country?
    7·2 answers
  • Blood leaves the heart to go to the rest of<br> the body through the
    14·2 answers
  • Will give brainiest!
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!