1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
777dan777 [17]
3 years ago
11

Which structure is lined with simple squamous epithelium?

Biology
1 answer:
vlabodo [156]3 years ago
4 0

Answer:

En los tejidos epiteliales, las células están estrechamente unidas entre sí formando láminas continuas que tiene distintas características: q No están vascularizados, por ello se nutren por difusión. q Como regla general, debajo de todo epitelio siempre hay tejido conectivo (la lámina basal).

Explanation:

You might be interested in
What steps of the rock cycle involve heat
Mnenie [13.5K]
The igneous rock and metamorphic rock
5 0
3 years ago
Only 3% of the water on earth is fresh water, the kind we need for drinking and growing food. Of that 3% , how much is locked in
spin [16.1K]

about...69%

or more than two-thirds

4 0
3 years ago
_______ are the small sacs that are the site of gas exchange in the lungs. In addition to being an airway, the _______ is the lo
tatyana61 [14]

1. D

2. C

3. B

4. A

5. Alveoli

6. larynx

7. mucus

8. nitrogen

9. diaphragm

10. Air enters the body through the mouth or nose and passes through the pharynx and larynx. Then it travels down the trachea and branches through the bronchi into the two lungs. In the lungs, small alveoli are the site of gas exchange where carbon dioxide diffuses into the lungs for exhalation, while oxygen from the air diffuses into the capillaries surrounding the alveoli to be pumped throughout the body.

PENNFOSTER.

add me as brainliest hehe <3

7 0
4 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
{ WARNING IF YOU ANSWER THIS YOUR NOTIFICATIONS WILL BLOW }
Jet001 [13]

Answer:

Albert Einstein is a German-born physicist and scientist who has created many ideas and theories relating to the study of relative. He is famously known for creating the famous equation e = mc^{2} (Energy equals mass times the speed of light squared).

He was involved in the help of creating nuclear powered- mechanisms (not for destroying things, but for helpful, everyday things). Matter has an inherent amount of energy to it, mass can be converted (under the right conditions) to pure energy, and energy can be used to create massive objects that did not exist previously. Nuclear fission takes place when a heavy atomic nucleus, such as uranium, breaks into two or more smaller pieces with the release of some energy. During this process some of the mass of the original atom is converted into energy in accordance with the equation e = mc^{2}.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Identify each of the cell structures indicated in Figure 7–7 and explain its role in the cell. Be sure to indicate the letter th
    5·1 answer
  • What do you think could be done to reduce levels of carbon dioxide in the atmosphere?
    6·1 answer
  • Fermentation and aerobic respiration break down glucose to make
    11·1 answer
  • How is a scientific law different from other laws in society?
    10·1 answer
  • Animals in the same phylum may have different nervous system structures. For example, octopuses have large, complex brains while
    5·2 answers
  • Will Give Brainliest!
    5·1 answer
  • Someone pls help me with this
    6·1 answer
  • Question A.
    13·1 answer
  • Why is the temperature in Seattle more stable than Minneapolis, even though they are at similar latitudes
    9·1 answer
  • Which body part contains the most number of mitochondria??
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!