1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
What type of substance is a coenzyme?
stellarik [79]
Vitamin-like is the answer.
5 0
4 years ago
All of the following are parts of the cell theory EXCEPT: a All cells will arise from pre-existing cells. b All living things ar
True [87]

Answer: All cells must show movement

Explanation:

The cell Theory states that:

- The cell is the structural and functional unit of life

- All living organisms are made up of cells

- All cells come from previously existing cells

- There is no life apart from the life of cells

- All living things are either with a single cell (unicellular) or a group of cells (multicellular)

Thus, the statement "All cells must show movement" is not a statement of the cell theory.

8 0
4 years ago
Read 2 more answers
Human gametes are _____.
jeka57 [31]
Humans gametes are oogamous.
8 0
3 years ago
Read 2 more answers
How is transformation in bacteria most accurately described?
Ratling [72]

Answer:

How is transformation in bacteria most accurately described? After mixing a heat-killed, phosphorescent (light-emitting) strain of bacteria with a living, nonphosphorescent strain, you discover that some of the living cells are now phosphorescent. ... Descendants of the living cells are also phosphorescent.

Explanation:

4 0
3 years ago
NEED THIS ANSWERED BEFORE CLASS IS OVER!!!!!!!!!
ololo11 [35]

ecosystem is the right answer

7 0
3 years ago
Read 2 more answers
Other questions:
  • To restore soil’s fertility, a farmer might plant legumes as part of a soil conservation technique called nutrient depletion. tr
    5·2 answers
  • How old dose boy’s hit puberty
    7·2 answers
  • Which is harmful Role of bacteria
    6·1 answer
  • Help me ASAP 20 points<br><br> How can the World Trade Organization promote biodiversity?
    14·1 answer
  • When normal microbiota become pathogenic and produce disease they are called opportunistic pathogens?
    15·1 answer
  • What geologic forces shaped Michigan?
    7·1 answer
  • Quade is studying for an exam, which will cover neurons and action potentials. He has drawn a diagram that shows the segments of
    10·1 answer
  • The Earth does not need a continual supply of materials.<br> True<br> False
    7·1 answer
  • The stage of the demographic transition that shows the most population growth is the
    8·1 answer
  • Plants are natures___________ conditioners ​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!