1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
Connects two dna strands by forming a bond between the phosphate group of one strand and the deoxyribose group on another
Maslowich

Answer:

DNA Ligase

Explanation:

DNA ligase is an enzyme that connects nucleotides of DNA from the phosphate to the sugar.  This seems to match the provided description, therefore I believe it to be the correct answer.

7 0
3 years ago
Typically, there are __________ papillary muscles that project from the wall of the left ventricle and attach to the tendinous c
slamgirl [31]
It is called chordae tendinae or heart string
6 0
4 years ago
a point mutation changes the DNA sequence CGA to CGT, but the same protein is still produced. Which point mutation occourred?
Tpy6a [65]
Silent mutation.
.......
:)
3 0
3 years ago
What would cause a person to have headaches from the sun only when not wearing a hat?
Setler [38]
There are 4 main reasons, which we discuss in detail below:

Reduced tolerance for light

Greater sunlight sensitivity between attacks

Longer duration of sun exposure

Exposure to specific wavelengths emitted by sun

People prone to light-induced migraine episodes generally have a lower threshold for light. In fact, the light of an overcast and cloudy day can be enough to cause pain! Thus, even normal levels of light exposure—much less bright days—can lead to headaches and other migraine symptoms.
The tolerance for light can also be lower between attacks making people more sensitive even when they are not in pain. This means a person may not immediately have a headache while outside, but it may be building. And if you just came out of an attack, you may find that your symptoms linger as a result of sun exposure.
If you don’t have an immediate headache or migraine from the sun, experts have further suggested that the cumulative effect of sunlight exposure over time can be just as damaging. Ultimately, the longer you stay outside, the more likely you may develop a headache.

Lastly, the sun emits a spectrum of light wavelengths, one of the strongest of these being high energy visible light or what most people label blue light. In fact, blue light is everywhere—fluorescents, device screens, and other artificial sources as well. And blue light has been repeatedly identified as the most painful color of light for people with migraine. thus the combined effect of sun brightness and these painful wavelengths can be a dynamic duo of unpleasantness.
7 0
3 years ago
what is the relationship between changes in a species envionment and the effectivesness of the species reproductive strategies
Wittaler [7]
Adaption, during adaptation certain traits in a species can be passed on. When a change in environment is presented certain traits begin to develop when the species reproduce due to mutations in the DNA. The more the new trait due to mutation, is shown during reproduction the more it passes on from parent to offspring. EX.1: Polar bears, they originated from a brown bear but as the land began to get cold and snowy, certain mutations occured causing one offspring to be born with white fur. Once that bear began to reproduce the trait became more common, and due to the adaptation the polar bear could blend in to its surroundings more making it easier to hunt prey. Brown bears were not able to keep producing and living due to slowly dying off from starvation causing the trait of white fur to be more common. The species begin to mate with other species with similar traits to keep on surviving. I hope this answered something if not please message me.
8 0
4 years ago
Other questions:
  • Generally describe what forces ultimately shaped the earth into its modern form
    6·1 answer
  • What is another name for colonizing lands?​
    12·1 answer
  • When a school of fish spawns, the males and females release sperm and eggs into the water. A sperm and egg cell unite to form th
    5·1 answer
  • Mutations can be both harmful and helpful. Indicate which of these can be caused by a genetic mutation. A) AIDS B) influenza C)
    13·2 answers
  • Why is it important to<br> maintain exact chromosome number during asexual<br> reproduction.
    9·1 answer
  • What is something that parents can do to improve their child's academic self-esteem
    7·2 answers
  • It is commonly said that humans have 206 bones, but this is not always true. Explain using the term "sutural bones."​
    8·1 answer
  • Think about the known reactants (inputs) of cellular respiration. Which organism-level impact is directly related to the reactan
    11·1 answer
  • What percent of species become extinct when mass extinction occurs?
    7·1 answer
  • Help this is for a big test (so right answers only)(AP3X)
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!