1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
Which of the following climate categories is categorized by consistently freezing temperatures and constant low rainfall? This i
Lelechka [254]
Polar because it always is below 32 degrees and has no rainfall
5 0
3 years ago
Read 2 more answers
How do environmental scientists use technology to track polar bears?
Trava [24]

Answer: A

Explanation:

Apex

3 0
3 years ago
2. use the atomic number and atomic mass to indicate the number of subatomic particles​
lawyer [7]

Answer:hydrogen atomic no and mass no is 1. In hydrogen there is one electron ,one proton and zero neutron.

Explanation:

Neutron is zero because neutron

Nnumber =atomic no - mass no so 1-1=0.

4 0
3 years ago
Does skim milk contain roughage?​
egoroff_w [7]

Answer:

Yes.

Explanation:

6 0
3 years ago
Read 2 more answers
New world monkeys have:______.
Scilla [17]

Answer:

d num have broad and flat bodies

3 0
3 years ago
Read 2 more answers
Other questions:
  • Seasonal changes can be important to reproduction because ___________.
    10·1 answer
  • Two atoms re held together by an___when an electron transfer from one atom to the other
    11·1 answer
  • The most important health habit to increase life expectancy is:
    15·1 answer
  • What do hypotheses, theories, and laws have in common?
    11·2 answers
  • 6 character traits for paul revere
    9·2 answers
  • The digestive system breaks down materials into substances the body can use.what structure inside the cell is most similar to th
    7·2 answers
  • In pea plants, the allele for smooth seeds is dominant over the allele for wrinkled seeds. A pea plant with smooth seeds is cros
    7·1 answer
  • Which of the following is an example of organic matter?
    10·1 answer
  • Which accurately labels the cytoplasm?
    13·2 answers
  • What is evolution?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!