1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
Complete this sentence: Most living things use ____________ to make ____________ from glucose.
Contact [7]
THE ANSWER IS C:  oxygen, ATP
4 0
4 years ago
Read 2 more answers
The alleles for a given trait seperate during meiosis is known as
sergejj [24]
Mendel's law of segregation.
5 0
4 years ago
Read 2 more answers
What is a sustainable resource
krek1111 [17]

use of resources in a way and at a rate that does not lead to the long-term decline of biological diversity, thereby maintaining its potential to meet the needs and aspirations of present and future generations.

:)

3 0
3 years ago
HELP WILL BE REWARD BRAINLEST IF CORRECT Use the figure below to review the reactants and products of photosynthesis and respira
lana66690 [7]
I believe the answer to this is B
4 0
3 years ago
What is the best summary of the passage external and internal stimuli?
lara [203]

Answer:

B

Explanation:

8 0
3 years ago
Other questions:
  • What is most likely, over time, to give rise to a totally new species?
    13·1 answer
  • What do several different populations living together make?
    7·2 answers
  • Which two systems does the nose play a role in?
    14·2 answers
  • A cross between pea plants with red flowers and plants with white flowers resulted in all offspring with pink flowers. this expe
    10·1 answer
  • An organism that uses energy from sunlight to produce food
    8·2 answers
  • What does deforestation mean?
    15·2 answers
  • What will determine a plants height, environment, genetics, or both? Explain your answer
    14·1 answer
  • Discuss the distribution of earthquakes and volcanoes over the surface of the earth. Are they scattered at random or are they co
    9·1 answer
  • Which type of plate boundary produces seafloor spreading?
    9·1 answer
  • The branch of Biology dealing with structure function and Reproduction of cell is called​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!