1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
he __________ system works with the nervous system to protect important organs such as the brain and spinal cord. A) skeletal B)
Yakvenalex [24]
The skeletal system since the brain is apart of the skeletal system.
3 0
3 years ago
Read 2 more answers
gets BRAINILIST pls help need major help litarlly crying for help pls help me pls It question 11 of critical thinking 6th of 1.1
Dmitry_Shevchenko [17]

Answer:

In this interview for Think magazine (April ’’92), Richard Paul provides a quick overview of critical thinking and the issues surrounding it: defining it, common mistakes in assessing it, its relation to communication skills, self-esteem, collaborative learning, motivation, curiosity, job skills for the future, national standards, and assessment strategies.

Question: Critical thinking is essential to effective learning and productive living. Would you share your definition of critical thinking?

Paul: First, since critical thinking can be defined in a number of different ways consistent with each other, we should not put a lot of weight on any one definition. Definitions are at best scaffolding for the mind. With this qualification in mind, here is a bit of scaffolding: critical thinking is thinking about your thinking while you’re thinking in order to make your thinking better. Two things are crucial:

1) critical thinking is not just thinking, but thinking which entails self-improvement

2) this improvement comes from skill in using standards by which one appropriately assesses thinking. To put it briefly, it is self-improvement (in thinking) through standards (that assess thinking).

To think well is to impose discipline and restraint on our thinking-by means of intellectual standards — in order to raise our thinking to a level of "perfection" or quality that is not natural or likely in undisciplined, spontaneous thought. The dimension of critical thinking least understood is that of  "intellectual standards." Most teachers were not taught how to assess thinking through standards; indeed, often the thinking of teachers themselves is very "undisciplined" and reflects a lack of internalized intellectual standards.

Question: Could you give me an example?

Paul: Certainly, one of the most important distinctions that teachers need to routinely make, and which takes disciplined thinking to make, is that between reasoning and subjective reaction.

If we are trying to foster quality thinking, we don't want students simply to assert things; we want them to try to reason things out on the basis of evidence and good reasons. Often, teachers are unclear about this basic difference. Many teachers are apt to take student writing or speech which is fluent and witty or glib and amusing as good thinking. They are often unclear about the constituents of good reasoning. Hence, even though a student may just be asserting things, not reasoning things out at all, if she is doing so with vivacity and flamboyance, teachers are apt to take this to be equivalent to good reasoning.

This was made clear in a recent California state-wide writing assessment in which teachers and testers applauded a student essay, which they said illustrated "exceptional achievement" in reasoned evaluation, an essay that contained no reasoning at all, that was nothing more than one subjective reaction after another. (See "Why Students-and Teachers-Don't Reason Well")

The assessing teachers and testers did not notice that the student failed to respond to the directions, did not support his judgment with reasons and evidence, did not consider possible criteria on which to base his judgment, did not analyze the subject in the light of the criteria, and did not select evidence that clearly supported his judgment. Instead the student:

Explanation: I have had this one before.

5 0
3 years ago
You have eaten daal at lunch. Make a list of enzymes it will be acted upon and changes it will undergo before being absorbed in
Vaselesa [24]

Answer:

Amylase and protease enzymes act on daal eaten at lunch.

Explanation:

Daal is the Indian name of pulses. Pulses contains both protein and carbohydrates in large amount and our body cannot absorb these nutrients due to bigger size. For the absorption of these nutrients, they can be broken down into simpler substances with the help of enzymes. Amylase enzyme helps in the break down of carbohydrate while protease enzyme is responsible for the break down of protein.

6 0
3 years ago
What structure is attached to the nuclear envelope and lined with ribosomes?
sveticcg [70]

Good afternoon, Nicol3713. I think the answer would be B - Rough ER because the bound ribosomes are attached to the rough ER or nuclear envelope. It should be right. Let me know if you need any more help. Have a great day!!

5 0
3 years ago
Read 2 more answers
There are 40 individuals in population 1, all with genotype A1A1, and there are 25 individuals in population 2, all with genotyp
aliina [53]

Answer:

Genetic drift

Explanation:

Genetic drift can also be referred to as allelic drift, it refers to the variation in allelic frequencies within a particular population over a period of time. It can also be referred to as the random fluctuations in the number of genotypes within a population. Genetic drift is not influenced by the environment and is usually more pronounced in a small population of organisms.

For example, a population of birds can consist of green feathers and blue feathers with the green feathers as the dominant allele, but as a result of random fluctuations, the offspring may all be with green feathers and hence could eliminate or reduce the allele responsible for blue feathers over time.

5 0
3 years ago
Other questions:
  • What is the object of mitosis? What mechanism in mitosis allow this to occur?
    9·1 answer
  • What type of microscope would be best to view a piece of moldy bread? Explain
    15·2 answers
  • A typical human cell is approximately 10.00 10.00 μm in diameter and enclosed by a membrane that is 8.000 8.000 nm thick. What i
    14·1 answer
  • Which food component is indigestible by the body?
    11·2 answers
  • Any three characters of monkey​
    14·2 answers
  • A pack of dog is considered which level of bioligical organization
    6·1 answer
  • Scientists often turn to tropical forests when searching for new species. Why do you think this is?
    9·1 answer
  • Which is an ABIOTIC factor in biomes? *
    5·2 answers
  • I’m very smart. My hair is dark. I love to eat honey, insects, and bark. What am I (10 letter word)
    5·2 answers
  • Macth each description with the correct process
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!