1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
1.Sea oats
cluponka [151]

Answer:

Explanation:1.Sea oats

2.European beach grass

3.American beach grass

4.Bitter panicum

5.Salt meadow cord grass

6.Seashore elder

7.Coastal panic grass

Procedure: In two to four sentences, explain how you ranked the plants from most desirable to least desirable. Be sure to cite evidence from the data to support your rankings.

Hope This Helps!

3 0
3 years ago
How did some stickleback populations come to live exclusively in fresh water?
mihalych1998 [28]

Answer: Some sticklebacks were stranded in lakes that were formed in the ice age

3 0
3 years ago
Rock that forms when sediments from older rocks undergo lithification
Lubov Fominskaja [6]

Answer:

c

Explanation:

when to objects come together and conform or conjoin they take what make the better of one from the 2 that are malleable

6 0
2 years ago
PLEASE HELP
Reika [66]

Answer no copy paste

Homeostasis and thermoregulation

When temperatures are too low, these processes may be disrupted, which can lead to cellular damage and even death. Homoeothermic endotherms, such as bears, bats, and birds, regulate their body temperature by generating heat internally.

<u><em>please mark me as the brainliest and add thanks. </em></u>

7 0
3 years ago
What is involved in the process of artificial selection?
Darina [25.2K]

Answer:

Explanation:

Artificial selection is the process by which humans choose individual organisms with certain phenotypic trait values for breeding. If there is additive genetic variance for the selected trait, it will respond to the selection, that is, the trait will evolve.

5 0
3 years ago
Read 2 more answers
Other questions:
  • What is the difference between the question and hypothesis steps in scientific inquiry?a.The question step provides the question
    15·1 answer
  • Messenger RNA travels from the _________ to the __________ delivering information from a strand of DNA.. A) cytoplasm, cell wall
    11·1 answer
  • What are Components of DNA
    7·1 answer
  • Which of the following is the path of a nerve impulse through a neuron?
    14·2 answers
  • The external auditory canal ends at the
    14·1 answer
  • Story
    5·1 answer
  • When the solution concentration on the outside of a cell is greater than the solution concentrate on the inside of the cell, wha
    5·1 answer
  • Why is crossing over of the chromosomes during meiosis important? (multiple choice)
    9·1 answer
  • Help in the science pls (my gramm3er is dead)
    7·1 answer
  • Semmelweis first promoted the use of disinfecting agents during surgery, such as the spraying of phenol in the operating room. T
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!