1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
2 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]2 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
Which of the following objects would experience the greatest acceleration if the same unbalanced force were applied to each?
REY [17]

Answer:

A=An object of mass 1 kg

Explanation:

3 0
2 years ago
Bones contain more____ than any other organ.
uysha [10]
Your answer is C.Calcium.

Hope this helps :)
5 0
3 years ago
A sedimentary rock that is composed of material evaporated from seawater is called?
charle [14.2K]
A chemical sedimentary rock?
4 0
3 years ago
A -cell can present an anitgen to -cell
enot [183]

Explanation:

under what circumstance does a negative cell presents An antigen to another negative cell

8 0
3 years ago
What temperature allows for the best solar panel operation ? ​
insens350 [35]

Answer:

I think temperature 25°c / 77° F or lower

Explanation:

how to meant to be wrong

6 0
2 years ago
Other questions:
  • What should be done after a spill is wiped up with a cloth?
    15·1 answer
  • A scientist discovers a new organism living deep beneath the earth surface this organism thrive despite intense pressure heat la
    10·1 answer
  • What three steps describe how an animal obtains and uses energy for growth
    7·1 answer
  • Polarity is important because polar and nonpolar molecules have
    11·1 answer
  • Donna is concerned about her adolescent daughter's tendency to flare-up at the mildest provocations. Donna says that her daughte
    15·1 answer
  • Two students studying physiology taste a known "bitter" substance, and both report sensing bitterness. They then sample another
    5·1 answer
  • Please help me out. Please
    15·1 answer
  • Microevolution, or evolution at its smallest scale, occurs when
    13·1 answer
  • Shania wanted to see if eating apples would help her do better on her class work, the first day she didn't eat any apples. On da
    15·1 answer
  • A malignant lesion of the forehead measuring 1.0 cm was removed. The operative report states skin margins are 1.1 cm on all side
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!