1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
Jayden was goofing around with a friend when he fell and hit his head. soon after, he was having difficulty with his vision. it
amm1812
An injury to the frontal lobe
5 0
3 years ago
Beyonce and Jay Z want Blue Ivy to have a sibling. However, Beyonce is worried because Jay Z has a unibrow (a dominant trait). S
weeeeeb [17]

The trait that is dominant or reccessive can be obtained by the use of a Punnet square or by the use of the conventional crossing of allele pairs.

<h3>What are traits?</h3>

The term traits refers to the expressed characteristics of an organism. The dominant trait is expressed while the reccessive trait is not expressed.

The trait that is dominant or reccessive can be obtained by the use of a Punnet square or by the use of the conventional crossing of allele pairs.

Learn more about traits:brainly.com/question/7602134

#SPJ1

4 0
2 years ago
Why is the person with low level of hoemoglobin feels tired soon walking​
Georgia [21]

Answer:

When you have too little hemoglobin or not enough red blood cells, your body doesn't get enough oxygen so you feel tired or weak.

Explanation:

6 0
3 years ago
Write 2 interesting facts about an earthquake that occured a decade ago
Paul [167]
<span>The 1906 earthquake in California, about 5:12 am on April 18, was before the Richter scale, but scientists estimate it would rank as a 7.8. As much as 90% of the damage in San Francisco was from fires caused by cracked gas pipes. San Francisco burned for three days and nights.
 
</span>The December 26, 2004 Indian Ocean earthquake located <span>off the west coast of Sumatra, </span><span>Indonesia </span>lasted nearly 10 minutes—the longest on record. <span>

</span>
8 0
3 years ago
Read 2 more answers
You are given two true-breeding groups of rabbits. The first group has floppy ears and white coat color. The second group has st
malfutka [58]

Answer:

Option E, Floppy ears are dominant over straight ears; coat color is determined by incomplete dominance

Explanation:

Let the allele for floppy ears be "F" and the allele for straight ears be "f"

And Let the allele for black coat color be "B" and the color for white coat color be "b"

Now, the cross is carried out between the first group having floppy ears and white coat color (FFbb) and the second group having straight ears and black coat color (ff BB)

The 16 offspring have genotype FfBb

Phenotype of 16 offspring is Floppy ears and grey coat

Ff represents the floppy ear , thus "F" is dominant over "f"

Bb represents the grey color which is a case of incomplete dominance in which none of the real trait i.e black or white is expressed.

Hence, option E is correct

6 0
3 years ago
Other questions:
  • Transcription translation errors often result in physical, or ___________, changes in an organism.
    9·2 answers
  • Which of the following describes catabolic reactions?
    14·1 answer
  • you find a plant unfamiliar to you and observe that it has vascular bundles scattered throughout the stem cross section. what do
    6·1 answer
  • The oldest Hawaiian island is the largest one. True or False
    6·1 answer
  • In a population of owl monkeys, allele T codes for tufted tails ( TT and Tt). The
    8·1 answer
  • What is the alignment of the Earth, moon, and sun during a solar eclipse?
    12·2 answers
  • 17. Why is learning theory valuable for a dog trainer?
    10·1 answer
  • How much light energy is converted to electrical energy in commercial solar panels
    7·1 answer
  • Multiple Choice
    8·1 answer
  • The large intestine connects with the small intestine at the.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!