1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
Lee believes that for every 3500-calorie reduction in his diet he will lose one pound. why is lee incorrect?
timama [110]
His body will react as if he is being starved, this causing his basal metabolic rate to drop.
8 0
3 years ago
It is best to add just enough dye to cover the smear so reagents are not wasted. If the
nika2105 [10]
False the goal was to cover the smear if it evaporates the smear is uncovered meaning the goal wasn’t meant. It could also be true though because you could just apply more dye to cover it up. So it might be true
8 0
2 years ago
What is the mechanism that causes the continents to move
dimulka [17.4K]

Answer:

It's All About the Plates

Heat from the Earth's interior causes this motion to happen via convection currents in the mantle. Over a period of millions of years, this slow motion caused the single supercontinent to split into the seven continents you see today

3 0
3 years ago
Read 2 more answers
Use homologous chromosome in a sentence
balu736 [363]
Despite a homologous chromosome pair having the same gene position the genes may contain different alleles 
6 0
3 years ago
Even if blood is carefully collected into a tube that has not been treated with an anticoagulant, it will clot. Which part of he
frutty [35]
Try one of these two sites 
http://www.easynotecards.com/notecard_set/72457
https://quizlet.com/11577780/blood-3-flash-cards/
6 0
3 years ago
Other questions:
  • Which event occurs FIRST in an astronaut’s day?
    6·2 answers
  • The chart shows characteristics of two groups of reptiles.
    13·2 answers
  • A division happens in the next step. which describes the cells after the next step is complete ?
    15·1 answer
  • What are reptoids? Give a detailed account of them and what they look like!
    6·1 answer
  • In a force of 12 N is applied to an object with a mass of 2 kg what will be its acceleration
    10·2 answers
  • Biotic factors are the _____. A)living things in an environment
    11·1 answer
  • How can air pollution affect groundwater?
    15·2 answers
  • ________ is a prolonged period of abnormally high temperatures, usually in association with humid weather.
    5·1 answer
  • What are the six kingdoms of life?
    11·1 answer
  • 36. What are the two smaller tubes that branch off of the trachea?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!