1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
Which sentence best explains how a wetland forms?
kkurt [141]

Answer:

A water from rain or springs flows downhill in a narrow channel

8 0
3 years ago
Read 2 more answers
True or False: Each mineral is made of an element, or a combination of elements, that are arranged in a definite repeating struc
lorasvet [3.4K]

Answer:

True

Explanation:

for a substance to be a mineral it must be a naturally occurring inorganic crystalline solid that has a characteristics chemical composition and Crystal structure

5 0
3 years ago
How do the offspring plants compare to the parent plants?
rodikova [14]
They carry a combination of their genetic traits.
8 0
3 years ago
Does voltage from deep brain stimulation damage brain tissue
Masja [62]
No. Deep Brain Stimulation blocks the defective electrical signals that can cause tremors and more movement symptoms.
3 0
3 years ago
Which are vegetative propagation techniques?
otez555 [7]
<span>Only one plant is involved and the offspring is the result of one parent. The new plant is genetically identical to the parent this is counted as reproductive. </span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • 1. Whats a difference and a similarity between<br> the Water Cycle &amp; Carbon Cycle?
    10·1 answer
  • Which statements accurately describe elements? Check all that apply. Elements are made up of two or more types of atoms. Element
    8·2 answers
  • The extracellular matrix is thought to participate in the regulation of animal cell behavior by communicating information from t
    13·1 answer
  • What are the macromolecules DNA and RNA referred to as?
    13·1 answer
  • Everybody meu-nbht-zzn
    14·2 answers
  • What happens first when a bladderwort catches a
    14·1 answer
  • Place the human into each of the seven hierarchical taxonomic categories, beginning with Kingdom and ending with the scientific
    9·1 answer
  • arrange the organisms from fastest to slowest based on the the time theyd take to complete the 20th carnegie stage
    9·1 answer
  • What are symptoms of vaccination??<br>wrong answer will be reported ​
    15·2 answers
  • Three cells are placed in three solutions of different concentrations. Determine the concentration of the solutions based on the
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!