1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
What is tRNA and its role/function
GREYUIT [131]

Answer:

is to bring amino acids to the ribosome for protein production.

Explanation:

7 0
2 years ago
What are “cones” in the eye and what do they do?
dusya [7]

Answer:

Cone cells, or cones, are photoreceptor cells in the retinas of vertebrate eyes (e.g. the human eye). They respond differently to light of different or color vision and function best in relatively bright light, as opposed to rod cells, which work better in dim light. Cones are mostly in the center of your retina. They help you see color and fine detail.

Explanation:

3 0
3 years ago
When biuret solution is used as an indicator, it turns from blue to purple in the presence of which organic molecule?
Furkat [3]

Answer:

B

Explanation:

The biuret solution will turn from blue to purple when it is exposed to protein. The copper sulfate and potassium hydroxide cause the substance to become an alkaline.

5 0
3 years ago
Read 2 more answers
When new bare land has been created or the ecosystem has been severely damaged by a fire, what is likely to occur?
Angelina_Jolie [31]

Answer:

C. pioneer species begin the process of succession

Explanation:

3 0
3 years ago
A hypothesis that has been verified by many scientists.
butalik [34]
A hypothesis that has been verified by many scientists is called a scientific theory. Scientific theory can be derived from careful examination of facts and thorough testing and proving of the different scientists. A hypothesis is an intelligent guess about a certain situation or problem. Whenever this hypothesis would be verified many times by many scientists, this would be<span> under now the category of scientific theory.</span>
5 0
3 years ago
Other questions:
  • The Animal Functional Genomics Laboratory at Mississippi State University conducts genetic research involving farm animals. The
    9·2 answers
  • Is there one place on earth where we can see the complete geologic column? How and why?
    15·1 answer
  • Discuss cell surface transport in the structure of constituents
    12·1 answer
  • How does the control group setup in an experimental differ from the other setups in the same experiment?
    9·2 answers
  • What are the two main functions of DNA​
    7·2 answers
  • Write a brief report about what causes cancer cells to develop.
    7·2 answers
  • fish living deep beneath the oceans surface are rarely or never displayed at seawater aquariums why?​
    7·1 answer
  • Which substance is a nucleic acid ?
    9·2 answers
  • How every organism on earth affect each other??? please help ..​
    15·1 answer
  • Which of the following is NOT an ecosystem
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!