1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
Rna differs from dna in all except which of the following ways?
Misha Larkins [42]

i need more information what are the choices?

5 0
3 years ago
Which of the following is a radical?<br><br><br> O<br><br><br> OH<br><br><br> H 2 O<br><br><br> H
Olegator [25]

The radical in this question is OH.


The reason this will be a radical, is that the definition of a radical is the presence of an unpaired electron. This causes the radical to be unstable, desperately wanting to do something with the free electron that it has.


Oxygen has a charge of 2-, and Hydrogen has a charge of +1. When you pair them, you end up with a net charge of 1-, which is the presence of that unpaired electron. It will usually be written as: OH^{-}

8 0
3 years ago
Read 2 more answers
O C. mitochondria 2. Where is the major site of photosynthesis in a plant? * O A. the stem O B. the roots O C. the leaves​
myrzilka [38]

Answer:

Option C

Explanation:

The answer to this question is option C or "the leaves." The major site of photosynthesis in a plant is where the chloroplasts are located because it contains chlorophyll which is where photosynthesis takes place, chloroplasts is in all the green parts of a plant stem, leaves, and even the branches but it takes place mainly in the leaves of a plant because there is more leaves then roots or branches.

Hope this helps.

4 0
3 years ago
Efficacy of sglt2 inhibitors on bone mineral density in japanese patients with type 2 diabetes
kolbaska11 [484]
Qwertyuiop[]\';lkjhgfdsazxcvbnm,./'

8 0
3 years ago
Recently it has been proposed that three domains be added to our hierarchy
Daniel [21]

Answer: C. Above the kingdom level

Explanation:

Hierarchical classification can be defined as the system of grouping living beings according to the level or orders. Domain secures the highest taxonomic rank in the biological hierarchical classification system. This lies above the Kingdom level. The life forms are classified into three domains, which are Archea, Eukarya and Bacteria.

4 0
3 years ago
Read 2 more answers
Other questions:
  • How is framing contributing to the decline in biodiversity
    9·2 answers
  • if energy and matter cannot be created or destroyed, what happens to energy and matter when an organism is eaten?
    10·2 answers
  • When molecules undergo passive transport which way do they move?
    10·1 answer
  • What are the two types of nucleic acids which viruses may have?
    7·2 answers
  • What are the 4 chambers of a sheep's stomach ?
    12·1 answer
  • Describe at least two biological systems. Explain how the systems are independent from an interconnected with each other.
    15·1 answer
  • What type of water produces an electric current? =
    13·2 answers
  • 7. Name TWO reasons why photosynthesis is an important process.<br>.<br>*​
    13·2 answers
  • Explain how eating a burger is the result of photosynthesis​
    12·1 answer
  • The most prevalent type of antibody in the blood is
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!