1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
True or false: Theoretically, it is possible (but very difficult) for a population to not evolve for a while.
Debora [2.8K]

It is true that it is possible for a population to not evolve for a while.

There is something called the Hardy-Weinberg theorem, which characterizes the distributions of genotype frequencies in populations that are not evolving.

There are 5 Hardy-Weinberg assumptions:

  • no mutation
  • random mating
  • no gene flow
  • infinite population size
  • and no selection (natural nor forced).

You can see that some of these are kinda extreme and really hard to get, but with approximations, we can work.

For example, instead of an "infinite population size" we have enough with a really large population, such that genetic drift is negligible.

Concluding, yes, it is possible (but really difficult) for a population to not evolve for a while (at least, in nature), as long as the 5 assumptions above are met.

If you want to learn more, you can read:

brainly.com/question/19431143

7 0
3 years ago
If adh secretion is inhibited which of the following will initially result
Feliz [49]

Answer:

A.

Explanation:

The number of aquaporins would increase in response to the inhibition of ADH.

Hope this helps!

7 0
2 years ago
Explain what nuclear, or atomic, process most likely results in geothermal energy. Also state why this nuclear energy will last
ELEN [110]

Explanation:

Nuclear energy does not produce electricity on its own. The nuclear energy it produces is used to heat water . The hot water then turns to steam that is used to turn dynamo turbines. This is thermal energy turned to mechanical energy.  The dynamo turbines turn the mechanical energy into electric energy.

Nuclear energy lasts longer because the same volume as compared to fossil fuels produced a larger magnitude of energy, million of magnitudes larger. Therefore with the controlled release of this enormous energy, nuclear energy can last much longer than fossil fuels.

Learn More:

For more comparisons between nuclear energy vs fossil energy check out;

brainly.com/question/9564636

brainly.com/question/7801962

brainly.com/question/5628547

brainly.com/question/9982762

brainly.com/question/10218784

brainly.com/question/7850572

brainly.com/question/1736879

brainly.com/question/3760263

brainly.com/question/3602665

#LearnWithBrainly

4 0
3 years ago
Which answer choice best explains why tractor trailers take more time to speed up and slow down than regular cars?
lawyer [7]

Answer:

sorry but i need the points

Explanation:

3 0
3 years ago
What is the bottom layer of skin? hypodermis epidermis dermis submit rewatch?
quester [9]
The answer is the dermis.
4 0
3 years ago
Other questions:
  • Organism at the end of a food chain
    13·1 answer
  • How many more trees are there in Canada than florida?
    5·1 answer
  • A by-product of involuntary muscle contraction and relaxation is:
    9·1 answer
  • In intestinal epithelial cells, a transport protein moves the bulky, polar glucose molecules through the membrane into the cytop
    9·1 answer
  • What macromolecules can be found in animal cells
    15·2 answers
  • Macrophage cells undergo a process called phagocytosis in which material is brought into a cell in the form of membrane vesicles
    11·1 answer
  • Cancer is a disease that usually results when A. a person has limited exposure to sunlight. B. mutations cause a person's body c
    5·1 answer
  • Describe how scientists and biologists study the world
    7·2 answers
  • What is the relationship between natural selection and mutations?
    12·1 answer
  • ……….. are organic substances required in small quantities for our body
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!