1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
HIV can remain latent for several years and not cause any symptoms in its host. What viral reproduction cycle is occurring durin
lakkis [162]

Answer:

The lytic cycle.

Explanation:

<u>HIV is a retrovirus</u> that has a special enzyme called transcriptase reverse, which can synthesize DNA using RNA as a template. This replication system is particularly useful for the virus because the DNA synthesized from the RNA viral genome can be then integrated into the human chromosomes and stay inactive for years. This is called a lysogenic cycle and is characterized by a latency of the virus and an integration to the host DNA.

When there is a triggering event, <u>this latent virus can be excised from the human chromosome and start producing copies of itself using the host machinery.</u> <u>Then the virions are assembled and after that they lyse the host cell and release new infective units that can then infect neighboring cells. </u>This is called the lytic cycle of the virus and is the reproduction cycle that occurs when a person moves into the acquired immunodeficiency syndrome (AIDS) stage of HIV infection.

6 0
3 years ago
How do scientist use models to predict the weather?
muminat
Using computers they can measure how much rainfall is in one area or in multiple areas at a time and predict how much more rainfall is going to come later on.
7 0
4 years ago
Please Help!!!!!!!!!!!!!!!!!!
earnstyle [38]

Answer:

I'm not quite sure but I'll try and figure it out if I don't get back to you I'm sorry but I will try.

Explanation:

5 0
4 years ago
In dehydration synthesis A. the molecule is decomposed into carbon dioxide and water. B. larger molecules are decomposed into sm
Phoenix [80]

Answer:

D. monosaccharides are joined

Explanation:

Dehydration synthesis can be described as the process of coming together of two molecules or compounds, followed by the removal of water.

In every dehydration process there must be loss or lacking if water.

Dehydration synthesis is also classified as a condensation reaction because

during a condensation reaction, there is is condensation of two molecules and also water is lost to form a large molecule which same as dehydration synthesis.

For instance, a dehydration synthesis occur in the formation of maltose from two molecules of glucose.also molecules, such as carbohydrates as well as proteins are formed through same process.

Therefore since dehydration synthesis involve coming together of two molecules then the best option is that monosaccharides are joined

5 0
4 years ago
What is the Plate Tectonics Theory?
katrin [286]

Answer:

The plate tectonics theory is that there are PLATES covering the earth's surface. This theory also says that they may cause earthquakes and cause volcanos to form!

Have a wonderful day!

5 0
3 years ago
Other questions:
  • Can someone please help me with this one problem I don’t understand it.
    6·1 answer
  • HELPPPP: Which statement describes ALL living things? A) They must reproduce sexually. B) They are composed of one or more cells
    8·2 answers
  • NEED HELP DUE TODAY PLZ HELP ME!!!!
    14·2 answers
  • When did humans arrive in North America?
    10·1 answer
  • What must happen before meiosis can begin
    12·2 answers
  • WILL MARK BRAINLIEST!!!!Which of the following processes express the information encoded by DNA
    14·1 answer
  • It for dreelliot 1/2 divided by 1​
    8·1 answer
  • HELPPP!!!! AG CLASS
    5·1 answer
  • Fossils of organisms that are different than today's organisms and are found in deeper rock layers indicates that
    14·1 answer
  • What are the only type of living organism that possess a prokaryotic cell?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!