1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dlinn [17]
3 years ago
12

What is the complementary strand for the following DNA segment? C A A G T T C G A T G A

Biology
1 answer:
Kazeer [188]3 years ago
6 0

GTTCAAGCTACTGTTCAAGCTACT

You might be interested in
Which of the following best describes how an atomic property is used in the treatment of cancer?
Andrew [12]
I think c sorry if I’m wrong
4 0
3 years ago
The name of hermone that calcium concentration in blood, called?
Mekhanik [1.2K]

Answer:

The parathyroid hormone

5 0
3 years ago
Except for _____, birds are the only known species that can fly.
aivan3 [116]
Except for bats, brids are the only known species that can fly. 
8 0
3 years ago
Read 2 more answers
Which is a example of a situtaion this is in equilibrium
Keith_Richards [23]

An example of a  situation in equilibrium is the amount of money in a bank account never changes.

What is Equilibrium?

Equilibrium is a point where the supply and demand are perfectly equal.

Equilibrium can be of two types:

  • dynamic equilibrium
  • static equilibrium

Example of equilibrium conditions include:

Chemical equilibrium - this refers to the equilibrium that exists in chemical systems. This form of equilibrium is a dynamic equilibrium where even though conditions in the system remain constant, the molecules in the system are constantly changing.

See-saw equilibrium - this is a static equilibrium where there os no change occurring in the sytem.

An equilibrium state is reached when when the supply and demand is equal such as the case when the amount of money in a bank account never changes.

In conclusion, equilibrium state is constant and never changes.

Learn more about equilibrium at: brainly.com/question/517289

#SPJ1

8 0
2 years ago
If you shine a light in one eye of a healthy animal, what should happen?
Eduardwww [97]
What does constrict mean if I know that then I know the answer
7 0
3 years ago
Read 2 more answers
Other questions:
  • What would be the result if crossing over did not happen during meiosis in humans
    5·2 answers
  • Why should we protect an entire ecosystem and not just one species?
    15·2 answers
  • How does the cell wall contributes towards maintaining homeostasis in the cell​
    6·1 answer
  • You are given an electron micrograph of a bacterial cell. In the micrograph you can clearly see three thin layers of different d
    9·2 answers
  • Marisol is sitting in a bus that is passing by a traffic light which statement correctly describes Marisol's motion
    8·1 answer
  • Which would be the producer in a food chain?
    14·2 answers
  • Your dog licked the last of your spaghetti off your plate. Why might you wash it in bleach water? (Remember to refer to bacteria
    9·2 answers
  • What's the correct order of the thunderstorm life cycle, from its beginning to its end?
    7·2 answers
  • HELP ASAP
    9·2 answers
  • Select the Ocean Basemap (Esri) from the Basemap drop-down menu at the top right. Also select the Regional Bathymetric Contours
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!