1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sasho [114]
2 years ago
12

Based on the excerpt, which statement best summarizes the author’s beliefs about the disappearing species? the loss of plant spe

cies and habitats will lead to widespread animal extinction. The loss of plant species and habitats will lead to environmental problems in remote regions. The loss of plant species and habitats will displace animals and decrease human wealth. The loss of plant species and habitats will devastate animals and hinder human progress.
Biology
1 answer:
ANTONII [103]2 years ago
7 0

The statement 'the loss of plant species and habitats will lead to widespread animal extinction' is TRUE.

<h3>What is biodiversity?</h3>

The term 'biodiversity' refers to all types of diversity in the tree of life (e.g. phenotypic and genetic diversity).

Plants are producer organisms that sustain many different ecosystems and the biodiversity in these areas.

The loss of biodiversity (extinction of species) may completely disrupt an ecosystem in an irreversible way.

Learn more about biodiversity here:

brainly.com/question/11542363

You might be interested in
The RN anticipates the specimen will be prepared in the lab and examined for identification. What is the term describing any pro
babymother [125]

Answer:

The technique is known as "staining"

Explanation:

Staining is a technique used to enhance the color contrast of the microscopic samples when observed in the microscope especially in the microbiological samples.

In the given question, when the staining technique is used to identify the sample then staining procedure is followed in a process where the samples can be identified on the basis of the color contrast which is in the case of gram staining.

The gram staining is used to identify the bacteria on the basis of color as the bacteria which appear blue in color are called gram-positive and the bacteria which appear red in color are gram-negative bacteria.

Thus, staining is the correct answer.

6 0
3 years ago
What do plants use to transport substances from one part of their bodies to another? vascular tissues hyphae cuticles vacuoles
Finger [1]
Vascular tissues are used for transport, the xylem carries water and the phloem carries food.
8 0
3 years ago
An inference _______.
adell [148]
1. a. <span>is a possible explanation for events using prior knowledge

An inference </span><span>is a possible explanation for events using prior knowledge, therefore, inference is an educated guess which can provide a logical reasoning to an object,  phenomenon or circumstance.

</span>
<span><span>2. d. the amount of time ... </span>
 </span>Since the amount of time can't clearly be controlled but only observed the other factors which is water, soil and type of plant can be manipulated in the study.


6 0
4 years ago
Why are the Miller-Urey experiments essential to the theory of evolution? They showed that life can only come from life. They sh
Evgen [1.6K]

Answer:

They showed how organic molecules could be made from Earth's early atmosphere.

Explanation:

Miller-Urey experiments were based on the ides of a-bio-genesis. It means the production of life through the non biological factors. In this experiment it shows that life can be produced through chemicals and molecules that were found in the early form of earth and is composition.

It kind of gives off to the evolution theory and the amino acids which are the building blocks of life and were given rise to during the simulation.

4 0
3 years ago
Read 2 more answers
Scientists first found dinosaur fossils about 1820. The fossils suggested that dinosaurs were large, slow, reptiles. This view w
kherson [118]

Answer:

C

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Please help! I am horrible at Biology.
    14·1 answer
  • Which explains why the reflex reaction is important in certain situations? a. Connect parts of the brain b. Connect the brain to
    7·2 answers
  • a young patient has increased thirst and is very fatigue, the doctors tell the patient that the pancreas is not functioning prop
    14·1 answer
  • Why digestive enzymes in a cell are enclosed in a membrane bound organell
    7·1 answer
  • Plz help asap!!!!!!!!!!!!!!
    13·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • What is a herbivore?
    14·2 answers
  • What are 5 fun facts about cytoplasm?
    8·2 answers
  • Along with the kidneys, the ureters, bladder, and urethra make up the urinary system. Match each function or description to the
    6·1 answer
  • A characteristic of an index fossil is that they must have general features...<br> True or False?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!