2 years ago

What/who are primary consumers in the food chain process?

Biology

1 answer:

lubasha [3.4K]2 years ago

3 0

Answer:

Explanation:

Ruminant animals. Cows, goats, zebras, and giraffes are examples of primary consumers and these herbivores feed on plant material like grass, branches, and roots.

Birds. Many birds are examples of primary consumers because they only eat seeds, cherries,

You might be interested in

Which structures in the diagram are composed of RNA?

zavuch27 [327]

There is no diagram here, so I cannot answer.

7 0

3 years ago

A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th

IgorC [24]

Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations

5 0

3 years ago

Turkey vultures eat carrion, which is decaying animal matter, like roadkill. How are they classified?(1 point)

otez555 [7]

Carnivore !! because carnivore means an animal that feeds on flesh!!!!!....your welcome :)

5 0

2 years ago

Read 2 more answers

A plant cell remains unchanged in shape or size when it is kept in a solution. What kind of solution is it?

larisa [96]

The answer is an isotonic solution.

If plant cell is in the isotonic solution, it will remains <span>unchanged in shape or size. This is because </span>

8 0

3 years ago

Which of the following is a problem associated with hands-free devices?

aliya0001 [1]

The answer is b. This is the answer because sometimes the hands free devices can be more dangerous than phones

6 0

3 years ago

Read 2 more answers