Answer:
The answer is D, binary fission
Answer:
The core is in a cube structure, extreme temperatures make the atoms to move so quickly that there is no alteration of the structure hence, no melting.
Explanation:
In the case of extremely high temperatures, atoms change position but still keep their original shape.
Further explanation:
In the case of high temperatures, the atoms making up a cube move rapidly and change position, the change of position is the melting.
Sickle cell trait is apparently an adaptation for the prevention of Malaria. Sickle cell trait is a condition in which the red blood cells are abnormally shaped, if they inherit two faulty copies of the gene for the oxygen-carrying protein hemoglobin. The faulty gene persists because even carrying one copy of it confers some resistance to malaria. As a result, the frequencies of sickle cell carriers are high in malaria endemic areas.
Yeah your answer is correct
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
