1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lozanna [386]
3 years ago
8

In animals, the production of body cells is classified as asexual reproduction, but the production of reproductive cells or game

tes is part of sexual reproduction. Which statement BEST describes the gene sequencing?
Biology
1 answer:
raketka [301]3 years ago
7 0
Hello

The type of asexual reproduction done by prokaryotic cells is termed as the binary fission. Binary fission is a reproduction process wherein one cell divides asexually into two cells forming two daughter cells. into In binary fission, the chromosome is being replicated in which the resultant prokaryote is exactly the same copy of the parental prokaryote which means to say that there is no chance for genetic diversity. However, prokaryotes can still share or even exchange genes through the mechanisms of  transformation, transduction and conjugation.
Have anice day :)
You might be interested in
List 6 living organisms found in hydrosphere​
Likurg_2 [28]

Answer:

The animals that can live in the hydrosphere and lithosphere are types of lizards and other amphibians that can burrow into the earth and live in the...

5 0
3 years ago
Read 2 more answers
the height of a type of plant is a normal distribution. Some plants are tall and some are short, but most are in between. What i
iragen [17]

Answer:

Many different genes control the height of the plants

hope this helps! <3

3 0
1 year ago
Arrange the following events in endochondral ossification in proper sequence:
LekaFEV [45]

Answer:

The correct answer is: c) 3, 2, 5, 1, 4.

Explanation:

Endochondral ossification is the process in which <u>bone tissue is formed from a cartilage model</u>, unlike intramembranous ossification in which bone cells originate from mesenchymal stem cells. Endochondral ossification is key to: 1) the rudimentary formation of long bones, 2) the growth in lenght of long bones, and 3) the reparation if bone tissue when the bone is fractured.

6 0
3 years ago
2. Scientists often work together with other scientists. If you were working in a scientific laboratory, how could you help peop
lions [1.4K]

Hi

I think a very important thing while working in a scientific laboratory is to have cooperation along with a sense of individual responsibility. There are many times when you are not expert in one scientific technique but your senior or fellow worker is because of his/her prior experience. At that point, the people of laboratory should cooperate with each other in giving some tips regarding performing a specific technique and getting the results with minimum time wastage. This does not mean that you take help from some one without giving them credit.

There should be a lab attendant in every lab who should be consulted for every problem so that he can assign some relevant worker to help you in the work. After you get the help, the attendant should confirm from both persons and keep a log about it which they should appreciate and give a fair credit about inquiries of higher authorities like supervisors.

Another important factor that is important for people is to have a sense of respect for each other. This is important to listen to others without just thinking about our own perspective and our own understanding. This also enables to understand a point from larger view and can help to bring a point in mind which we otherwise might skip.

8 0
3 years ago
The two types of plains are coastal plains and lowland plains T or F
ANTONII [103]
The answer i am almost certain is true

8 0
3 years ago
Read 2 more answers
Other questions:
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Which of the following statements regarding the genetic material of cells and viruses is true? A. The genes of both viruses and
    10·1 answer
  • Classify each process as weathering and erosion.
    14·2 answers
  • What product is common to reactions in cellular respiration and fermentation? oxygen ATP glucose pyruvic acid
    12·2 answers
  • A person living in a coma is considered living or dead?​
    5·2 answers
  • In the F2 generation of a dihybrid cross two phenotypes appear in the ratio 1:1. two phenotypes appear in the ratio 3:1. four ph
    5·1 answer
  • Pleeeaaasssseeeeee help!
    12·2 answers
  • (BRAINLIEST ONLY IF CORRECT! THANKS) Use the following table to answer the question:
    8·1 answer
  • NO LINKS The arctic is an environment in which the temperature is often below freezing. The polar bear and the walrus are both a
    10·2 answers
  • Check all that are functions of the blood in the body transports oxygen from the lungs to body cells
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!