1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mashutka [201]
3 years ago
11

Which aquatic environment would benefit the most from reduced runoff from lawns treated with fertilizers?

Biology
1 answer:
VladimirAG [237]3 years ago
6 0

The aquatic environment that would be most benefited from reduced runoff from lawns treated with fertilizers is lakes.

<h3>What do you mean by Aquatic environment?</h3>

Aquatic environment may be defined as ecosystem that completely surrounds with water bodies. It also involves the living organisms which are living in aquatic habitat.

The runoff from lawns treated with fertilizers directly flows into the lakes and from there they migrates to rivers. It affects the lakes by declining its biodiversity.

If these runoff from lawns treated with fertilizers are reduced, it may lead to the survival of aquatic species within the lake which maintains its biodiversity.

Therefore, the aquatic environment that would be most benefited from reduced runoff from lawns treated with fertilizers is lakes.

To learn more about Aquatic environment, refer to the link:

brainly.com/question/26073928

#SPJ1

You might be interested in
Assume you inoculated 100 cells, with a generation time of 20 minutes, into 100 ml of nutrient broth. You then inoculated 100 ce
Marina86 [1]

Answer:

a) the same number of cells in both

Explanation:

In cells reproduction, in both cases we consider the same specie, the same generation time, and we assume the same broth.

The only advantage of the container with more milliliters of nutrients is that when the population increases, it will need more nutrients, so maybe the reproduction rate in the container with 100 ml will be lower.

But if the temperature, the quantity of nutrients are the same in both containers, so the volume is not a variable to affect the speed or low the reproduction rate.

6 0
4 years ago
Please help will give brainliest
frez [133]
Less freshwater! Good luck!
5 0
2 years ago
Read 2 more answers
identify the missing parts of the carbon cycle photosynthesis burning oil and coal respiration decomposers​
Ahat [919]

Answer:

Carbon is part of our bodies, but it's also part of our modern-day industries. Carbon compounds from long-ago plants and algae make up the fossil fuels, such Deeper under the ground are fossil fuels such as oil, coal, and natural gas, When humans burn them, carbon is released into the atmosphere as carbon dioxide.

Explanation:

Hope this helps :)

7 0
3 years ago
What levels of polypeptide structures are shown above?A=Secondary, B= No structural level, just a poypeptide, C = TertiaryO A= S
suter [353]

To answer this we need to remember how proteins are structured, the primary structure is just the polypeptide chain, secondary there is a certain folding level alpha-helix and folded beta-sheet, then is the tertiary structure that comes from a single polypeptide chain and is formed by secondary structures, finally, there is the quaternary structure where several polypeptide chains are involved as well as tertiary structures are folded together. Therefore taking this into consideration we can say that the correct answer is option two.

7 0
2 years ago
Predict the Earth Mass (ME) of an exoplanet with an Earth Radius measure of 3.2 RE.
Morgarella [4.7K]

The relationship is modeled by the equation y = 7.7079x - 7.

Here, y is the dependent variable which is the Earth Mass, and x is the independent variable which is the Earth Radius.

Solving for the Earth Mass if Earth Radius is 3.2 (x=3.2), we substitute 3.2 to x.

7.7079(3.2)-7

=7.7079 times 3.2 -7

=24.66528-7

=17.66528

7.7079(3.2)-7=17.66528

6 0
3 years ago
Other questions:
  • One major grouping of hallucinogens typically allows the user to remain in some touch with the real world and to remember much o
    11·1 answer
  • Put the following terms in order of decreasing size
    15·1 answer
  • DNA would be found within which classification of biological molecules?
    5·2 answers
  • Select the correct answer from each drop down menu.
    10·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Applying Osmosis
    13·1 answer
  • HELP ASAP PLEASEEE ??! :)
    12·2 answers
  • Please help me <br>is importe ​
    5·1 answer
  • Please help me out I'm being timed for this plz look at the picture of the question please and thank you
    10·1 answer
  • 1. How might the daily experiences of people contribute to their belief the earth and species do not change?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!