1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
frozen [14]
2 years ago
11

Are bacteria and viruses types of diseases?​

Biology
1 answer:
Drupady [299]2 years ago
6 0

Answer:

Technically, no. But note that these can both <em>cause</em> diseases.

You might be interested in
What can you tell about an igneous rock that has a fine texture?
alukav5142 [94]

Answer:c

Explanation:it is most likely extrusive

5 0
3 years ago
Which of the following examples can cause gene flow between populations?
I am Lyosha [343]
Bird droppings that contain seeds from a different location" is the correct answer. Sometimes when seeds from different areas are ingested, the genetic material is passed on.  
8 0
2 years ago
Read 2 more answers
Which of these is an agent of abrasion?
patriot [66]

Answer:

A. Rock pieces

Explanation:

Abrasion is the breaking down and wearing away of rock material by the mechanical action of other rocks. Three agents of physical weathering that can cause abrasion are moving water, wind and gravity. None of those are agents of abrasion. But Rock pieces are a result of abrasion.

3 0
3 years ago
What happens to an animal cell in a hypertonic solution?
jarptica [38.1K]

<span>The answer is that cell will shrink.</span>

<span>If you put an animal cell in a hypertonic solution means that concentration of the solutes is greater outside the cell, in the solution, than in the cell. Consequently,</span> the water concentration of the cell's cytoplasm is higher than that of the hypertonic solution. Since the aim is to balance water concentration on the inside and outside of the cell, the water will exit the cell. The cell will lose water and, consequently, will shrink in size.

5 0
3 years ago
What is offspring ? please help
Lapatulllka [165]

Answer:

Offspring,

Explanation:

Offspring a person's child or children:

"the offspring of middle-class parents"

6 0
2 years ago
Other questions:
  • Which procedure involves the surgical removal of an entire breast and many of the surrounding tissue?
    14·1 answer
  • Organisms in the Euglenophyta are
    6·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How long will it take you to reach Fujairah from Dubai if you drive at the speed of 120 km/h. (Hint the distance between Dubai a
    6·1 answer
  • How do you think the amount of sugar molecules in a photosynthetic plant changes over the course of a sunny day? Explain your an
    15·2 answers
  • 55:51
    14·1 answer
  • MCQ ...help me........​It's a last question
    14·1 answer
  • Sample 1<br> sample 2<br> sample 3<br> sample 4
    7·1 answer
  • Opción que contiene los elementos que favorecieron el asentamiento de las culturas mesoamericanas​
    6·1 answer
  • Which of the following explains why randomized controlled trials are often "double blind"?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!