The answer is "an American Colony".
"The ordinary man knows that [Saudi Arabia] is the largest oil producer in the world, yet at the same time he is suffering from taxes and bad services. Now the people understand the speeches of the ulemas in the mosques--that our country has become an American colony. They act decisively with every action to kick the Americans out of Saudi Arabia. What happened in Riyadh and [Dhahran] when 24 Americans were killed in two bombings is clear evidence of the huge anger of Saudi people against America. The Saudis now know their real enemy is America." - Osama Bin Laden, July 10th, 1996
Answer:
equator sun
Explanation:
the winter solstice explained. at 6:12.a.m. EST on Friday (Dec 21) , <u>the</u><u> </u><u>sun</u><u> </u><u>wil</u><u>l</u><u> </u><u>rea</u><u>ch</u><u> </u><u>a</u><u> </u><u>po</u><u>int</u><u> </u><u>wh</u><u>ere</u><u> </u><u>it</u><u> </u><u>wi</u><u>ll</u><u> </u><u>ap</u><u>pear</u><u> to</u><u> </u><u>shine</u><u> </u><u>farthe</u><u>st</u>
to the South of the equator, over the tropic of Capricorn , Thus markingthe moment of winter solstice -the beginning of the winter.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Hi there,
The climate in Saudi Arabia, Iraq, and Iran is mainly Desert.
Those places are located around the Middle East area and the Middle East is covered in dry hot sand so it'll make sense that Saudi Arabia, Iraq and Iran is a desert.
Hope this helped :)
Have a great day
<span>plates slip or grind in the pass each other</span>