1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nutka1998 [239]
1 year ago
13

Are Radar waves used to re-heat and cook food?

Biology
1 answer:
My name is Ann [436]1 year ago
6 0

Answer:

I think it would be yes

Explanation:

Microwaves and infrared waves can heat up food but does not make food radioactive. The waves cause vigorous vibration of molecules in food resulting in high temperature that cooks the food.hope this helps if not let me know.

You might be interested in
Explain how a child can have a different phenotypic characteristic that neither parent has
Elenna [48]
You are lucky because I just finished learning this! 

See a child or offspring that shows a dominant trait that is not shown in parents can be recessive for either one or both parents. So basically one or both parents might have a recessive trait that showed up in the offspring! 


7 0
3 years ago
HELP ME PLEASE I REALLY NEED IT
andrew-mc [135]

Answer:

No lo sé, pero gracias por los puntos.

Explanation:

6 0
2 years ago
Read 2 more answers
A particular diploid plant species has 48 chromosomes, or two sets. A mutationoccurs and gametes with 48 chromosomes are produce
PilotLPTM [1.2K]

Answer:

The zygote will have 96 chromosomes.

Explanation:

If self-fertilization occurs, and two gametes (each having 48 chromosomes) unite, the zygote will have 96 chromosomes ( or 4 sets)

6 0
3 years ago
What kind of molecule is G3P? sugar lipid protein nucleic acid
Pie

Answer:

I think its lipid

Explanation: I am taking the test right now for grad-point  so tell me if i am wrong .

²

6 0
3 years ago
Read 2 more answers
When two or more simple machines are combined they form a(n) _____.
bekas [8.4K]
It is not c or d. I think it is a. 
5 0
3 years ago
Other questions:
  • Which statement concerning an ecosystem is correct?
    9·1 answer
  • What causes metamorphic rocks to form from existing rocks?
    8·1 answer
  • What does omsois and diffusion have in common
    9·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A hydrogen atom has 1 electron. How many bonds can hydrogen form? Question 7 options: 4 2 3 1
    8·2 answers
  • Water has the ability to dissolve salts and carry dissolved carbon dioxide. How does this action help the human body maintain ho
    5·1 answer
  • Is cystic fibrosis autosomal or sex-linked?
    15·1 answer
  • What is closer to the equator 10 degrees south or 20 degrees north
    8·1 answer
  • Which is the equation for photosynthesis?
    9·2 answers
  • How do vasoconstriction and vasodilation contribute to the homeostasis of body temperature ?​
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!