1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lakkis [162]
2 years ago
15

Which organelle is labeled H?

Biology
1 answer:
earnstyle [38]2 years ago
4 0

Answer:

A

Explanation:

it keeps everything inside together.

You might be interested in
Which resident's information would the scientist most likely record to get valid results?
pentagon [3]
Resident 1 is to give the most valid results. 
3 0
3 years ago
Which type of blood vessel usually carries oxygen-rich blood
zalisa [80]

Answer:

Arteries

Explanation:

There are three main types of blood vessels: veins, arteries, and capillaries. Arteries are the blood vessels that carry the oxygenated blood from the heart to various body parts. Veins pick the deoxygenated blood and deliver it to the heart to be oxygenated.  

Arteries are the blood vessels with thick walls and no valves. Blood is pumped with higher pressure from the heart into arteries. The pulmonary artery is the only exception that carries deoxygenated blood from the right ventricle to the lungs for oxygenation.  

5 0
3 years ago
Can you identify how chemicals cycle in an ecosystem?
natulia [17]
Nutrients move through the ecosystem<span> in biogeochemical </span>cycles<span>. A biogeochemical </span>cycle<span> is a circuit/pathway by which a </span>chemical<span> element moves through the biotic and the abiotic factors of an</span>ecosystem<span>. It is inclusive of the biotic factors, or living organisms, rocks, air, water, and </span>chemicals<span>.</span>
7 0
4 years ago
Name the respiratory system
Aleonysh [2.5K]

Answer:

The respiratory system is made up of the organs involved in the interchanges of gases. It consists of the:

Nose

Mouth

Throat (pharynx)

Voice box (larynx)

Windpipe (trachea)

Airways (bronchi)

Lungs

8 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • If the ecosystem is balanced, which populations should be the largest? Which should be the smallest?
    12·1 answer
  • What is photosynthesis
    7·1 answer
  • I need help in bio it’s due tomorrow pleaseee
    15·2 answers
  • Use numbers to indicate the order of steps in the pyruvate dehydrogenase complex: 1. _______Decarboxylation of pyruvate to an al
    11·1 answer
  • Describe the process of ovulation. Use the diagram above to explain your answer.
    13·1 answer
  • What is the highest level of organization that is represented in the photograph?
    14·1 answer
  • A group of three letters on DNA is called?
    8·1 answer
  • Aneuploidy in which chromosomes is most likely to be survived?
    11·2 answers
  • Using the __ of the dna, you can predict the sample separation profile in gel electrophoresis.
    8·1 answer
  • PLS HELP ME WILL MARK BRAINLYEST: Why is it important that people use fewer non-renewable resources and more renewable resources
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!