1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maslowich
2 years ago
12

What produces the cell cycle?

Biology
2 answers:
Marta_Voda [28]2 years ago
8 0

The cell cycle is an ordered series of events involving cell growth and cell division that produces two new daughter cells. Cells on the path to cell division proceed through a series of precisely timed and carefully regulated stages of growth, DNA replication, and division that produces two identical (clone) cells.

sorry if it is wrong

solmaris [256]2 years ago
4 0

Answer:

The cell cycle can be thought of as the life cycle of a cell. In other words, it is the series of growth and development steps a cell undergoes between its “birth”—formation by the division of a mother cell—and reproduction—division to make two new daughter cells.

You might be interested in
Which of the following correctly describes the difference between transcription and translation?
g100num [7]
A) Transcription makes RNA from DNA, translation turns RNA into proteins.
3 0
3 years ago
Read 2 more answers
When a counterfeit detection pen is used on an authentic bill, what color does it turn?
garik1379 [7]
If the bill is counterfeit and the paper is wood-based, the iodine in the pen solution will react with the starch and leave a dark brown or black mark.
7 0
2 years ago
In the first step of spermatogenesis, spermatogonia differentiate cells into
mojhsa [17]

Answer:

B. Primary spermatocytes

Explanation:

The germ cell line is a group of cells found inside the seminiferous tubules. This germ cells undergo mitosis (creating spermatogonia) to have a steady supply of cells that will divide by meiosis to produce gametes. When spermatogonia divide by meiosis at the end of meiosis I the newly created cells are known as primary spermatocytes.

8 0
2 years ago
Please Help! ASAP It's another Biology question in photo
jenyasd209 [6]
I think the answer to this is E
7 0
2 years ago
Read 2 more answers
Suppose that a person eats a diet of 2397 calories per day.
timama [110]
So what's the question here?<span />
3 0
2 years ago
Other questions:
  • Which of the following levels of organization is the largest,Phylum,class,order,group
    9·1 answer
  • At the 1992 Earth Summit, representatives from around the world
    7·1 answer
  • How does asexual reproduction occur to budding
    12·1 answer
  • The cytoplasm is the watery fluid found within cells. The cytoplasm holds all of the organelles, except _______, in place within
    9·2 answers
  • NEED HELP NOW!!!! PLEASE HELP
    10·2 answers
  • Insertion into the brain of a thin insulated wire through which an electrical current is sent that destroys the brain cells at t
    10·1 answer
  • What is the only reasonable and ethical way to achieve zero population growth
    5·1 answer
  • __________ is the theory of inheritance states that genes are located on chromosomes which undergo segregation and independent a
    6·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The motor division of the Peripheral Nervous
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!