1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna [14]
2 years ago
9

What most likely happened to the population of deer in 1963 and 1964? a graph entitled population of white tail deer in michigan

from 1945 to 1962 has year on the horizontal axis, and population number on the vertical axis. from 1945 to 1951, the population increased rapidly. from 1951 to 1955, the population remained constant at 1600. from 1953 to 1959, the population decreased rapidly, and from 1959 to 2963 the population began to increase to around 750. the population increased its death rate. the population exceeded past carrying capacity. the population crashed down to 0. the population steadily increased to get closer to carrying capacity.
Biology
2 answers:
poizon [28]2 years ago
6 0

Answer:

A.

Explanation:

lana66690 [7]2 years ago
4 0

Answer:

The population steadily increased to get closer to carrying capacity.

Explanation:

You might be interested in
Anyone wanna ta.lk to me bc i bo..red
Irina18 [472]

Answer:

hmm.......................

4 0
3 years ago
Read 2 more answers
What is the mRNA that would be transcribed from this strand of DNA?
Illusion [34]

Answer:

AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication

Explanation:

8 0
2 years ago
Which of the following DOES NOT regularly use the atmosphere during its process?
drek231 [11]
I think it’s the water Cycle???
4 0
3 years ago
Molten rock flows onto the seafloor and hardens as it cools.
PIT_PIT [208]

i have the answer and it says C

3 0
3 years ago
How to stay mentally and physically healthy during online school​
Romashka-Z-Leto [24]

you have to stay mentally and physically healty with exercises.

8 0
3 years ago
Read 2 more answers
Other questions:
  • How would it be possible to classify the flagellates as protozoa, as algae, and as fungi
    7·1 answer
  • Which of the following is not apart of the Cell Theory? *
    9·1 answer
  • Wisdom teeth are the third and final set of human molars that come in during the late teens or early twenties. In some cases, th
    9·2 answers
  • The bending of waves as they enter a different medium is called?
    15·1 answer
  • Are the Celosia Plant flowers the plant seeds?
    13·1 answer
  • After a search of nucleotide sequence databases, researchers identified an IRE in the 5c untranslated region of a gene encoding
    15·1 answer
  • Why would farmers in the United States be especially concerned about a decrease in groundwater?
    11·1 answer
  • A population of large predators in an ecosystem has been trapped and removed from the area. How would this event most likely cha
    7·1 answer
  • Could a volcano pop up in Omaha?
    11·2 answers
  • What makes a bond polar?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!