1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sp2606 [1]
2 years ago
14

Question 1

Biology
2 answers:
garik1379 [7]2 years ago
7 0

Answer:

Neither can change the number of atoms of each element that are present.

Explanation:

took test

MArishka [77]2 years ago
4 0

Physical and chemical changes may be similar because neither can change the number of atoms of each element that are present.

<h3>What do you mean by Physical changes?</h3>

Physical changes may be defined as those changes which appeared physically like color, odor, texture, mass, and density.

Chemical changes may lead to the formation of new chemicals with definite properties. It involves when the chemical identity of any substance may alter.

Therefore, physical and chemical changes may be similar because neither can change the number of atoms of each element that are present.

To learn more about Chemical changes, refer to the link:

brainly.com/question/17384175

#SPJ1

You might be interested in
________ cannot be created or destroyed. It can only be transformed (from one type of energy to another, such as chemical energy
DedPeter [7]

Answer:

energy

Explanation:

7 0
3 years ago
How does the sun's energy help maintain Earth's energy budget?
RoseWind [281]
Essentially 100% of the energy that fuels the earth comes from the sun. To maintain a constant global average temperature, all of the sun's radiation that enters Earth's atmosphere must eventually be sent back to space. This is achieved through Earth's energy balance.
4 0
3 years ago
What is the red chicken's genotype?
Sedaia [141]
If red is recessive rr 

If red is dominant it could be RR or Rr 


3 0
3 years ago
Read 2 more answers
Will give brainliest:
yaroslaw [1]
The answer A. DNA in the nucleus controls all cell activity.
3 0
3 years ago
Read 2 more answers
Transcription is the synthesis of
den301095 [7]

Answer:

mRNA

Explanation:

why because the process begins of transcription is

RNA polymerase

5 0
3 years ago
Read 2 more answers
Other questions:
  • Based only on their anatomy, rank gorillas, bears, chimpanzees,
    7·1 answer
  • What is the function of lissome?
    12·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Which of the following is true?
    13·1 answer
  • How could you use iron filings to tell which of two bar magnets is stronger?
    10·2 answers
  • What type of plate boundary caused the formation of the Himalayas? Name another example of a mountain range that formed in this
    9·1 answer
  • Climate in a given region can be considered an average of that region's daily weather. true or false
    6·1 answer
  • Which statement describes an element? Check all that apply.Which statement describes an element? Check all that apply.
    15·1 answer
  • If you pass a magnet through a wire loop you can
    5·1 answer
  • If my oxsigen count is low how do l bring it up at the right level?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!