1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rus_ich [418]
2 years ago
15

Which of the following is true about protein molecules?

Biology
1 answer:
larisa86 [58]2 years ago
4 0

Answer:

A.

Protein molecules have many functions in the body, including the storage of genetic information.

Explanation:

You might be interested in
.Cells use ATP as a source of energy to carry out various functions within the cell. In order for ATP to be useful, a chemical r
Paul [167]
The correct answer is A.
6 0
3 years ago
Read 2 more answers
What does the earliest evidence of life look like in the fossil record​
soldier1979 [14.2K]

Answer:

Scientists have discovered what they say could be fossils of some of the earliest living organisms on Earth. They are represented by tiny filaments, knobs and tubes in Canadian rocks dated to be up to 4.28 billion years old.

Explanation:

5 0
3 years ago
What would be the drug of choice in an adolescent who is diagnosed with syphilis during the first trimester of pregnancy?
Arisa [49]

Answer:

Penicillin G

Explanation:

I remember this vaguely, remove or whatever if wrong.

5 0
2 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
2 years ago
Which organisms are likely to be found in the level labeled 4 in this diagram? Select the two correct answers.
andrey2020 [161]
The presented picture shows 4 trophic levels of the ecosystem.
The first level is made out of primary producers, plants. The second level is made out of herbivores that feed on the plants. The third level is made out of predators that eat herbivores.
The fourth trophic level is made out carnivores that eat other carnivores.
In our case, the only organism belonging to the fourth trophic level is the wolf.

8 0
3 years ago
Read 2 more answers
Other questions:
  • The longer evolution acts on a population, the _______ variation in forms it can produce. Therefore, when searching for large ev
    7·1 answer
  • 1. To calculate the frequency of the brown allele, count the number of and divide by the total number of alleles in this populat
    6·1 answer
  • What is a base?
    15·1 answer
  • How do all multicellular organisms begin? A. as complex organisms B. as a single cell C. by expanding the size of their cells D.
    11·1 answer
  • What will most likely happen to this ecosystem if the herring are killed by a virus?
    8·2 answers
  • 7.
    8·1 answer
  • If a solid contain some particles that amount and 50°C and other particles amount mount at 110°C what must be true about the sol
    15·1 answer
  • What does an equation that shows water and carbon dioxide combining to form glucose and oxygen represent
    9·1 answer
  • Warm water rises because it is ............ than cool water.
    7·2 answers
  • Which of the following is common to the nervous, endocrine and respiratory systems?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!