All categories

3 years ago

What is penicillin used for?

Biology

1 answer:

rjkz [21]3 years ago

5 0

I i used to treat infections caused by bacteria. And also ear, skin ad throat infections

You might be interested in

Differences between mono di and polysaccharides

timama [110]

Answer: monosaccharides are simple sugars made up of only a single sugar molecule. Disaccharides are sugars made up of two sugar molecules linked together by a glycosidic bond while polysaccharides are complex sugars made up of many sugar molecules linked together by glycosidic bonds.

Explanation: Examples of monosaccharides are glucose, fructose, and galactose, while examples of disaccharide sugars include maltose, lactose and sucrose. Examples of polysaccharides include glycogen

and starch.

7 0

3 years ago

All of the following are density dependent factors except

telo118 [61]

Answer:

B.Shelter

Explanation:

Density is defined as mass, Shelter is the only thing that did not contain mass

6 0

3 years ago

Read 2 more answers

When chromosomes become visible at the beginning of the cell division, wat does each chromosome consist of?

polet [3.4K]

They consist of identical sister chromatids

6 0

3 years ago

Census data show that the human population doubled from 2.65 billion in 1953 to 5.3 billion in 1990. If it continues to double a

madam [21]

The question is incomplete, the complete question is;

Census data show that the human population

doubled from 2.65 billion in 1953 to 5.3 billion

in 1990. If it continues to double at this rate,

the human population could reach 10 billion

by the year 2020. Which BEST explains how

this rate of human growth can harm the

environment on which humans depend?

A. by gradually making up more available energy

B. by using resources faster than they can be

replaced

C. by changing how matter cycles through an

ecosystem

D. by increasing the variety of ecosystems that are

Answer:

by using resources faster than they can be

replaced

Explanation:

As population of the world continues to grow, there is greater demands for resources which are obtained from the environment such as crude oil for energy, solid minerals for various applications, wood for furniture etc.

Demand for these materials increase exponentially as population increases thus they are extracted at a faster rate than nature can replace them. This will eventually harm the environment on which humans depend as population increases.

7 0

3 years ago

Read 2 more answers

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago