1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Luba_88 [7]
3 years ago
14

Brainliest to right answer!!

Biology
1 answer:
Lilit [14]3 years ago
8 0

Answer:Sun

Explanation:

You might be interested in
Please helpp meeee!!
PilotLPTM [1.2K]

Answer:

It is either C. or D. It is most likely D.

Explanation:

This is because the efficiency of solar power can vary based on the season or events. All in all, it cannot be completely reliable.

3 0
3 years ago
Suppose you have monohybrid flowers in your garden and find that they produce black seeds to brown seeds in the ratio of 3:1. If
Dvinal [7]
Hybrid = having one recessive and one dominant allele
This means that all of the flowers must have the genotype Bb.
Knowing this, let's make a Punnet Square.

\begin{tabular}{ l c } & B \ \ \ \ b\\ B & \boxed{BB}\boxed{Bb} \\ b & \boxed{Bb\ }\boxed{\ bb} \\ \end{tabular}

As you can see, 3 of these are going to have the dominant trait and 1 is going to have the recessive trait. This corresponds to our 3:1 in our question, meaning that the black seeds must be dominant and the brown ones recessive.

Because they are dominant, the genotype for black seeds could be BB <em /><em>or</em> Bb.
4 0
3 years ago
Read 2 more answers
The biomes that exist closest to the Earth's poles are describes as _______.
serious [3.7K]
The biome that exist closest to the Earth's poles are descibed as polar
7 0
3 years ago
The steps of protein synthesis
vlada-n [284]

Answer:

c is the answer

Explanation:

6 0
3 years ago
Many insects, fish, and mammals release certain chemical messengers to signal reproductive readiness. What are these messengers
My name is Ann [436]
Hormones I believe so
8 0
3 years ago
Read 2 more answers
Other questions:
  • Before testing the pea plants, Mendel formed a five-part hypothesis. What did Mendel include in his hypothesis? Check all that a
    15·2 answers
  • Match each scenario to it’s related biomolecules
    13·2 answers
  • Which describes an interaction within the musculoskeletal system?
    11·2 answers
  • What does the body do to maintain homeostasis easy version?
    13·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What enzyme starts the process of transcription?
    7·1 answer
  • Choose the correct word that describes the description. A substance that can dissolve in another substance. solute? solvent? sat
    12·1 answer
  • Species in which dark brown fur (D) is dominant relative to light brown fur (d). Using the Punnett square below, predict the fre
    13·1 answer
  • What do organ systems combine to form?
    11·2 answers
  • All Correct Statements Pertaining to the Dihydroxyacetone Phosphate Reaction Step in Glycolysis.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!