1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MakcuM [25]
2 years ago
7

The weather is warm and dry. What changes would a cold front bring?

Biology
2 answers:
Ksenya-84 [330]2 years ago
8 0

rain or thunderstorms

typically thunderclouds and storms are the post affect of a cold front, causing D to be your answer, MrKnowledge

maw [93]2 years ago
3 0

Answer:

Option D

Explanation:

  • Warm and dry weather is present
  • Warm air goes up
  • To avoid such free space air comes from all sides like a cyclone inorder to fill up that.
  • which would cause thunder storm with rain
You might be interested in
DNA is made up of many smaller molecules called _____.
drek231 [11]
It’s B I think bro. Use a different app this one sucks
4 0
3 years ago
Read 2 more answers
Which of the following weighing balances performs measurements in a closed compartment with no air currents to disturb measureme
Neko [114]
Hydraulic balance is the best choice
4 0
3 years ago
I just want to k ow if the answer is correct
brilliants [131]
I’m pretty sure that’s right
8 0
2 years ago
Read 2 more answers
All of the following help the cell regulate gene expression during Step 2 of protein formation EXCEPT
Aleks [24]

Answer:

All of the following help the cell regulate gene expression during Step 2 of protein formation EXCEPT

specialty factors binding to the RNA polymerase, altering its specificity

Explanation:

8 0
3 years ago
Consider the cladogram representing most of the major categories of animals. Consider the point B in the cladogram. What charact
Ahat [919]
C) Warm Blooded is the answer

8 0
3 years ago
Read 2 more answers
Other questions:
  • How Should the biological name of the giant water bug be written in binomial
    10·2 answers
  • The plasma membrane forms a barrier which is ___________ on the outer and inner surface and _____________ on the interior
    7·1 answer
  • Throughout the week,Emma reads 0.5 hour o Monday,Wendnesday,and Friday.She also reads 0.75 hour on Tuesday and Thursday.How many
    8·1 answer
  • What relationship between both an abiotic and a biotic factor in a ecosystem?
    7·2 answers
  • Does protozoa require a host for reproduction?<br><br> Yes<br> No
    10·1 answer
  • The activity of the kidneys is controlled by hormones and by ?
    11·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • My brother put random letters for points.<br> yall have em back please lol.
    10·1 answer
  • Explain how a person could die from drinking too much water. Be sure to use the following terms in your answer: diffusion, osmos
    14·1 answer
  • What combines in different<br> ways to make up all matter?<br> 1.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!