1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natulia [17]
4 years ago
11

What transports oxygen depleted blood to the lungs to exchange CO2 for O2?

Biology
1 answer:
anastassius [24]4 years ago
8 0

Answer:

Red Blood Cells

Explanation:

Oxygen is one of the substances transported with the assistance of red blood cells. The red blood cells contain a pigment called haemoglobin, each molecule of which binds four oxygen molecules. Oxyhaemoglobin forms. The oxygen molecules are carried to individual cells in the body tissue where they are released.

You might be interested in
. Why is Gandhi giving advice or comfort to Dr. King in this cartoon?
Allisa [31]
Because Gandhi a wise man and man full of respect and knowledge
3 0
3 years ago
Read 2 more answers
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Bethany thinks her dog is overweight so she switches the dog to a new brand of food for overweight dogs. the switch in dog food
gtnhenbr [62]

In psychology, the manipulation is described a change done, in order to obtain a certain result, but this does not guaranty that the result would be seen in future.  

In this case, the lady (Bethany) switches the diet of the dog. She thinks that switching the food of the dog can help the dog to lose weight. This may or may not be true.  

So, this case is an example of manipulation.  


5 0
3 years ago
Consider what you know about biotic and abiotic factors in an ecosystem. What is one of the reasons that nutrients in a vegetabl
Sedbober [7]

Answer:

Nutrients are mostly obtained from the soil

Explanation:

5 0
3 years ago
Read 2 more answers
What is the function of my DNA
fgiga [73]

Answer:

Your DNA is basically your human code

Explanation:

The DNA contains what makes you, well you, and it also contains the codes for how you will grow, your health, and reproduce. Your DNA is vital if it gets damaged or something happens along the way the message can't go through, that's when deformities and others things can happen.

6 0
3 years ago
Other questions:
  • Explain how you could determine wheater seeds in packets of round pea seeds have a genotype rr or rr
    14·1 answer
  • Identify which of the following factors are density-dependent or density-independent.---- Earthquake----- Disease----- Food-----
    6·2 answers
  • Which statements best describe science? Check all that apply.
    7·2 answers
  • 1 According to the dichotomous key on the previous page, what is a flightless man
    10·1 answer
  • (a) List the chemical characteristics of molecules that are most likely to move by simple diffusion across the lipid bilayer of
    12·2 answers
  • PLS HELP :( 25 POINTS + BRAINLIEST!!
    11·1 answer
  • Mrs. Lopez is a chemist who is studying salt crystals. She wants to slow the rate at which the crystals dissolve in a solution o
    8·1 answer
  • Which of these factors is associated with sustainable faming
    8·2 answers
  • Similarities between fungi and protists . WILL MARK U BRAINLIEST !! ( just need 2 )
    15·1 answer
  • Why is the brain the control center of your body?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!