1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sammy [17]
2 years ago
15

An individual has an infection with an acid-fast organism. From a clinical standpoint, how

Biology
1 answer:
melamori03 [73]2 years ago
3 0

Acid-fast bacteria or acid-fast bacilli can be defined as the group of bacteria that have the ability to resist their decolonization by the acids which are used during the staining process.

An infection that is caused due to an acid-fast organism indicates that the individual is suffering from Tuberculosis or other myobacterial diseases.

An acid-fast bacteria has many protective and invasive techniques which makes the infection difficult to treat, and thus, long-term course of antibiotics is needed for the treatment of such infections.

brainly.com/question/13216375

You might be interested in
Covalent bonds are chemical bonds between ions.<br> A. True<br> B. False
Simora [160]

i think it would be

A. True.

7 0
3 years ago
Read 2 more answers
In the conservation of species, protection of entire ecosystems ensures that _____. humans have no impact on the ecosystem abiot
lapo4ka [179]
Ensures that species interactions are preserved..

3 0
3 years ago
Read 2 more answers
Individuals producing an abnormal form of the extracellular matrix protein, fibrillin, is a result of ______.
erastova [34]

Answer:

Indivisuals with producing an abnormal form of extracellular protein fibrillin are suffering from Marfan syndrome ehich is caused by genetic mutation in the FBN1 gene.

Explanation:

Gene mutations in FBN1 gene results in the production of an abnormal extracellular matrix fibrillin-1 protein that cannot function properly. These gene mutations basically reduce the amount of fibrillin-1 produced by the cell, alter the structure of fibrillin-1, or causes the impairment of the transport of fibrillin-1 out of the cell.

As a result, protein is poorly incorporated into extracellular matrix. Hence, indivisuals with Marfan syndrome present following symptoms

Tall stature.

Disproportionately long arms, legs and fingers.

Sternum either protrudes outward or dips inward.

Arched palate and crowded teeth.

Heart murmurs.

Extreme nearsightedness.

6 0
3 years ago
Who can help me with thjs
Inga [223]
Don’t click on that link it’s fake... this is the answer

5 0
3 years ago
Complementary base-pairing rules simply state that
Rudiy27
I’m pretty sure the answer is D
7 0
3 years ago
Other questions:
  • The brain's outermost cellular layer is called the:
    12·2 answers
  • When a nurse rubs your skin with rubbing alcohol prior to administering an injection, what process(es) is he carrying out? selec
    14·1 answer
  • Which of the following activities would have the greatest impact on the amount of dirt, oil and other contaminants added to the
    7·2 answers
  • A larger population density always indicates a larger population size. True or False
    15·2 answers
  • What is the relationship between organelles, cells, tissues, organs, and organ systems?
    8·1 answer
  • What are common organic sedimentary rocks
    14·1 answer
  • Explain the role of the digestive, endocrine, excretory systems in maintaining homeostasis. PLEASE ANSWER FAST, BUT NOT RUSHING
    12·1 answer
  • Some types of cancers are caused by faulty genes. Scientists are researching methods for preventing and treating cancer with gen
    5·1 answer
  • What happens when troponin and tropomyosin block the active sites of actin?
    7·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!