1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
2 years ago
9

Which item could be dated using radiocarbon dating?

Geography
1 answer:
Mrrafil [7]2 years ago
8 0

Answer:

Fossils

Explanation:

Because most fossils are a hundred, thousand years old, even a million years old...65 million years, that is for the fossils of dinosaurs

You might be interested in
evaporation is different than precipitation in that a) evaporation is a product and precipitation is the process b) evaporation
Grace [21]
The answer to your question is D. evaporation is a process and precipitation is more of an element in that process.

3 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
The states can ask the Department of Health and Human Services for Grants to pay for​
bogdanovich [222]

Answer:

Maybe

Explanation

7 0
3 years ago
Santiago is the name of <br> a. chile’s capital. <br> b. a chilean saint. <br> c. a national park.
Marina CMI [18]
Santiago is the name of Chile's capital and largest city, <span>sits in a valley surrounded by the snow-capped Andes and the Chilean Coast Range. </span>
4 0
3 years ago
Read 2 more answers
According to the US State Department, what is human trafficking, and what major forms of it are seen around the globe?
Grace [21]
The action or practice of illegally transporting people from one country or area to another, typically for the purposes of forced labour or commercial sexual exploitation.

Major Forms of Trafficking in Persons

Major Forms of Trafficking in Persons.

Bonded Labor. ...

Debt Bondage and Involuntary Servitude Among Migrant Laborers. ...

Involuntary Domestic Servitude. ...

Forced Child Labor. ...

Child Soldiers. ...

Sex Trafficking and Prostitution.

Children Exploited for Commercial Sex.

3 0
3 years ago
Other questions:
  • How do you describe the location of a point on a coordinate plane?
    15·1 answer
  • The West Coast of the United State has features formed by _______.​
    10·2 answers
  • QUESTION 3 Sustainable development is all of the following EXCEPT: O A. uses resources without depleting them OB. considers impa
    11·2 answers
  • What are the types of erosion and definition
    10·2 answers
  • Many of the lakes in Florida are sinkhole lakes.Make a claim about the geology beneath Florida's surface?
    11·2 answers
  • What type of plate boundary would you expect at a reverse fault?
    15·1 answer
  • What mountain range separates india and china?
    10·1 answer
  • How are volcanoes distributed​
    13·1 answer
  • Discuss China’s one child policy?
    5·1 answer
  • Whats the most populated place on earth?? please hurryasap
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!