1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elis [28]
2 years ago
5

What is meant by maintaining homeostasis

Biology
1 answer:
777dan777 [17]2 years ago
8 0

Answer:

A property of cells, tissues, and organisms that allows the maintenance and regulation of the stability and constancy needed to function properly. Homeostasis is a healthy state that is maintained by the constant adjustment of biochemical and physiological pathways.

Explanation:

You might be interested in
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Which level of the energy pyramid has the least amount of energy available?
devlian [24]

the highest level which is the 'apex preditor' or in other cases its called a 'tertiary consumer'

4 0
3 years ago
What are two main food sources for lipids?
valkas [14]
I think Nuts and Fish
5 0
3 years ago
Read 2 more answers
From the time a baby is born, what is she or he eager to do?
marusya05 [52]

Answer:

D. Play with her parents, primary caregivers, and toys

4 0
3 years ago
After teaching a group of students about anticoagulants, the instructor determines that the teaching was successful when the stu
yulyashka [42]
<h2>The correct answer is Salicylates</h2>

Explanation:

  • Salicylates when interact with Warfarin increases the risk of bleeding.
  • Salicylates are chemicals which are derived from Salicylic acid.
  • Salicylates are present naturally in foods.
  • Pineapple,orange,grapes, guava, fresh apricots,broccoli,capsicum, radish,cucumber,corn etc. possess Salicylates.
  • Salicylates is synthetically produced.
  • Salicylates is used in products such as toothpaste, aspirin and food preservatives.
  • Health problems are seen when salicylates is consumed in large doses.
  • A smal dose can affect the health of a person, If he is salicylates intolerant.
8 0
3 years ago
Other questions:
  • If global warming continues at its present rate, about 1oc/century, which biomes will likely take the place of the taiga
    14·1 answer
  • Characters traits can be discovered by analyzing __________.
    7·2 answers
  • (oxygen, electron transport chain, chemiosmosis, NADPH)
    10·1 answer
  • I don’t know llllllllllllllllllllllllllll
    8·2 answers
  • Plants use carbohydrates to build things such as cellulose. How do plants acquire these building blocks to build mass?
    13·2 answers
  • If there are 4 grams of reactant, how many grams of product are produced by the chemical reaction?
    10·1 answer
  • Bats have oversized ears, which helps the bats use sound waves to detect the motion of their prey. Which example of the characte
    10·2 answers
  • Which of the following is an example of homeostasis?
    11·1 answer
  • If energy is needed to remove a phosphate group from a chain in ATP you can conclude that the energy needed for production must
    7·1 answer
  • Identify the organ labeled x.​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!