Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
There are multiple energy source in the ocean. The one thats probably the most common one are Dams. Although Dams can cause some serious flooding. Another one is Tidal energy. Tidal energy is something that turns the energy of tides into energy through Kinetic motion.<span />
Sugar comes from either sugar cane or sugar beet<span> with the climate of a geographical region being the prime influence on which is grown. In both cases, the juice is extracted from the </span>sugar beet<span> or cane and impurities are removed. It is then crystallised into white sugar, which is 99.95% sucrose.</span>
The reaction of sodium bicarbonate (baking soda) and acetic acid (vinegar) produces carbon dioxide gas, water and sodium acetate (soluble in water). The carbon dioxide gas can originally be seen as bubbles in the solution, but will quickly be released from the solution.
The type of ion channels responsible for the depolarization phase of an action potential are Na+ (sodium)
channels. Sodium ions flow inward through the sodium channels and cause an
increase in the concentration of positively charged ions in the cell; this in
turn, leads to depolarization.
