1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KengaRu [80]
2 years ago
9

How is night vision an adaptation for an owl in a desert environment?

Biology
1 answer:
aleksklad [387]2 years ago
7 0

Answer:

b. it helps the owl avoid being hunted.

It can see clearly using the nocturnal vision and hence escape predators and find prey.

You might be interested in
Let P = purple flowers and p = white, and T = tall plants and t = dwarf. What combinations of gametes could be produced by a het
kirill [66]

Answer:

The combinations of gametes that could be produced from heterozygous individuals for both traits are PT, Pt, pT and pt.

Explanation:

An individual is heterozygous for two traits, flower color and stem height, with a PpTt (dihybrid) genotype and a phenotype showing the dominant traits, purple flowers and tall stem.

The genes of this individual for the above-mentioned traits contain different alleles, and taking into account the independent segregation of characters, the alleles present in its gametes could be:

  • <em>Both dominant alleles: PT </em>
  • <em>One dominant and one recessive allele Pt or pT </em>
  • <em>Both recessive alleles: pt </em>

Therefore, the traits of its offspring will depend on the alleles for those traits present in the gamete to which they are combined.

6 0
3 years ago
What will MOST LIKELY happen to an ecosystem if the birthrate of consumers increases?
Over [174]
It will also increase
3 0
3 years ago
Read 2 more answers
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
The cytric acid cycle requires the presence of _____ for completion
Andrew [12]

Answer:

Oxygen

Explanation:

8 0
3 years ago
Which is an important function of the cell structure in this model.
Mariana [72]

Answer:

Cells provide the necessary structural support for an organism.

P.s you should link or photograph the model

6 0
2 years ago
Other questions:
  • When the maximum amount of oxygen is being transported?
    8·1 answer
  • Which organs preform both mechanical digestion and chemical digestion of food
    11·2 answers
  • The tertiary structure of a polypeptide is the Select one:_________
    7·1 answer
  • How do plants obtain energy and food
    7·2 answers
  • Science help pls, thankssssssss
    7·1 answer
  • How does hemoglobin function as a pH buffer?a.Hemoglobin binds hydrogen ions when carbon dioxide exits the red blood cell. b.Hem
    5·1 answer
  • Which list below describes the next steps of evaporated water through the water cycle?
    14·1 answer
  • Is squids shooting out ink behavioral adaptation?
    7·2 answers
  • What type of physical evidence is acquired through the senses<br><br> help quick
    9·1 answer
  • Describe the coordination between the nervous system and the glandular system in human body
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!