1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vekshin1
1 year ago
14

Which chromosomal defect is caused when part of a chromosome breaks off and reattaches backward on the same chromosome?

Biology
1 answer:
Y_Kistochka [10]1 year ago
8 0
Deletion is when a part of the chromosome is deleted. (Removed)
Insertion is when part of our chromosome has an extra bit added to it.
Translocation Is when one part of the chromosome is moved to another chromosome.

The correct answer is inversion, to invert means to turn upside down. So when part of the chromosome is taken off but attached backwards (turned upside down) we call it inversion

Hope that makes sense
You might be interested in
____ feedback is when the body reacts in the same direction as a stimulus.
Rom4ik [11]

Answer:

negative

Explanation:

6 0
3 years ago
Read 2 more answers
The half — life of nickel is 96 years. How much of a 30-gram sample is left after 270 years?
-Dominant- [34]

The amount of the 30 gram-sample that will remain after 270 years is 6.61 grams

<h3>How to determine the number of half-lives </h3>

We'll begin by obtaining the number of half lives that has elapsed. This can be obtained as follow:

  • Half-life (t½) = 96 years
  • Time (t) = 270 years
  • Number of half-lives (n) =?

n = t / t½

n = 270 / 99

n = 2.8125

<h3>How to determine the amount remaining </h3>
  • Original amount (N₀) = 30 grams
  • Number of half-lives (n) = 2.8125
  • Amount remaining (N) =?

The amount remaing can be obtained as follow:

N = N₀ / 2^n

N = 30 / 2^2.8125

N = 6.61 grams

Learn more about half life:

brainly.com/question/26374513

#SPJ1

5 0
1 year ago
Explain three ways in which red blood cells are adapted to their function​
Salsk061 [2.6K]

Answer:

Red blood cells are adapted to their function by:

1) They contain haemoglobin - a red protein that combines with oxygen. they have no nucleus so they can contain more haemoglobin.

2) They are small and flexible so that they can fit through narrow blood vessels.

3) They have a biconcave shape (flattened disc shape) to maximise their surface area for oxygen absorption.

Hope this helps! :D

8 0
3 years ago
Read 2 more answers
Human activities have altered many natural environments ________. Many lands are now fields where only one farm crop is grown, a
marysya [2.9K]

Human activities have altered various natural environments around the planet. Various lands are now fields where only one farm crop is cultivated, is an example of monoculture farming.  

An agricultural method of growing or producing a single plant, crop, or a livestock species, breed, or a variety in a field of the farming system at a time is known as a monoculture. Hence, the correct answer is option D, that is, monoculture.  


7 0
2 years ago
How do fossil fuels contribute to air pollution?
postnew [5]

Answer:

A) releasing carbon dioxide into the air

6 0
3 years ago
Read 2 more answers
Other questions:
  • Which is found only in plants of the phylum Anthophyta? asap!!
    8·2 answers
  • ____________ is the period of time between conception and birth when a baby grows and develops inside the mother's womb. A) Gest
    7·2 answers
  • Migratory behaviors, such as the particular routes animals use, are said to be _____.
    6·2 answers
  • The pattern of transcription for a pair of identical twins (Tweedledee and Tweedledum) is very similar at the age of 10. However
    5·1 answer
  • Economic impact of aflatoxin on health and agriculture
    9·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following organisms in the soil food chain does not obtain energy directly from plants?
    7·2 answers
  • Identify the following structures of a plant cell using the diagram to the right.
    15·1 answer
  • UPPIO.Stuuyisland.com Earth's Water Systems Tools Save Session Pablo is building a miniature watershed model of his city out of
    10·1 answer
  • The ___________ is an example of bone as an organ; ___________ bone is an example of bone as a tissue.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!