All categories

2 years ago

A. Refine the graph by adding the interval of time of extinction with a label drawn from the table as shown by “a”.

Biology

1 answer:

Tomtit [17]2 years ago

8 0

Answer:

$\\ \\ \\ \\ \\ \\ \\ \\ \\ \\ \\ \\ \\ \\ \\ \\ \\ \\ \div \red{div}$

You might be interested in

AUUUAACUGUUCUGUCUAGAG

Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0

3 years ago

Herbivores get energy by eating plants. Plants get energy from sunlight. Why does most of the energy captured by plants never be

qwelly [4]

Answer:

Because they lose most of the energy as heat when they perform metabolic activities

Explanation:

Cells of all living organisms require energy in form of ATP to perform their cellular functions. In an ecosystem, organisms obtain this energy by feeding on one another. However, these energy transfer starts from organisms capable of using sunlight called PRODUCERS e.g plants.

Herbivores, which are PRIMARY CONSUMERS get their energy by feeding on these plants. However, according to the PYRAMID OF ENERGY, which represents the flow of energy in an ecosystem, only a few portion of the energy (about 10%) derived by plants from the sun gets transferred to herbivores. This is because most of the energy (about 90%) is lost as heat when the plants undergo metabolic activities.

8 0

3 years ago

Read 2 more answers

Identify the stage of meiosis pictured below.

Rudiy27

Answer:

The answer to your question is d) Metaphase ll

Explanation:

Metaphase ll is the second stage of Meiosis ll after Profase ll. During this phase, chromosomes align along a single plane in the center of the cell. As we can see in your picture.

During this phase, the chromosomes are preparing themselves to be divided in the next phase (Anaphase ll).

4 0

3 years ago

Which of the following is true about the cells of the human body?

Mamont248 [21]

Answer:

Explanation:

I think because environmental factors can affect personality and language but not the cell structure itself

hope this helped :)

7 0

3 years ago

Read 2 more answers

Describe the structure of atoms,including the masses, electrical charges, and locations of protons, neutrons and electrons.

Lana71 [14]

Everything on earth is made up of a fundamental particles that is impossible to see with the naked eye this particle is called the atom. There a over a 100 atoms or more in science. At the center of the atom is the nucleus which contains protons and neutrons. Electrons can be found moving around the orbitals or energy levels , while most of the area outside the nucleus is empty space .

Most of the mass of an atom is concentrated at the center of the nucleus.

Atoms are made up of three subatomic particles called

1. Protons

2. Neurons

3. Electrons

protons - has positively charge particles with a charge

of +1

Neutrons- has no charge it is neutral, 0 charge.

Electrons- has a negative charge particles with an charge of -1.

Relative mass of a particle is the mass compared to the mass of a proton

Relative charge of a particle is the charge compared to the charge on a proton.

7 0

4 years ago