The correct answer is that "t<span>roponin holds the tropomyosin in place on the actin".
In excitation-contraction coupling, tropomyosin prevents the interaction between actin and myosin in resting muscles. In the event of excitation, there is release of calcium from the sarcoplasmic reticulum wherein the troponin will bind this calcium and will release tropomyosin and expose myosin enabling it to attach to actin and therefore facilitating muscle contraction.</span>
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
The answer is: Because a subject might involuntarily manufacture a false memory and believe it is true.
Hope this help ❤️
Answer:
Which type(s) of cell division reduce(s) the chromosome number by half?
Meiosis l
Which type(s) of cell division can be classified as reductional?
Meiosis I
Which type(s) of cell division can be classified as equational?
Mitosis and Meiosis II
Explanation:
Meiosis is a type of cell division which occurs in the germ or reproductive cells to produce gametes. It is completed in the two stages, meiosis I and meiosis II. The cells which are going to divide by meiosis are diploid having two sets of chromosomes. Meiosis I is the first stage of the meiosis. At the end of meiosis I two daughter cells are formed having only 1 set of chromosomes and chromosome numbers are reduced to half. Thus, meiosis I is a reductional division.
Mitosis and meiosis II is the equational division as after division chromosome number remains the same as in the parent.
