1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Akimi4 [234]
1 year ago
15

Please help i'm stuck on this and it's due soon, questions are in the images, will give brainliest!

Biology
1 answer:
UkoKoshka [18]1 year ago
3 0

From the photographs presented, investigation reveals that the gender and age of the victim are:

  • Age: Elderly, at least 40 years old;
  • Gender; Female. This is clear from the hip and the shoe type discovered as the scene.

<h3>What is the preliminary hypothesis on the cause and manner of death?</h3>

The hypothesis or cause of death is a gun shot to the head. This is evidenced by the exhibit 23 - a bullet shell and the hole in the skull of the victim.

The databases that can help with these kind of investigations are:

  • The Crime Database
  • The Police Database.

Learn more about investigations at:
brainly.com/question/2219589
#SPJ1

You might be interested in
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
How does DNA affect genetics?
Basile [38]

Answer:

Over our lifetime, our DNA can undergo changes or mutations that result in differences in the DNA sequence and may affect the proteins that are made. Mutations can occur as a natural consequence of errors in DNA replication or as a result of exposure to environmental factors such as smoking, sunlight or radiation.

Explanation:

5 0
2 years ago
Which statement is the most accurate regarding the first stage of photosynthesis?(1 point)
ser-zykov [4K]

B is the answer, it wants me to type more so hehehhe

5 0
2 years ago
Give two distinguishing features of class Amphibia​
iragen [17]

Answer:

the distinguishable features of these creatures include moist, scaleless skin and cold-blooded. Amphibians absorb water and respiration occur through their skin.

8 0
3 years ago
______ species are much more prone to extinction.
MArishka [77]
B. Specialist
Let me know if you need any other help!
6 0
3 years ago
Other questions:
  • Six-year-old Demetri and 4-year-old Lucien's mother gave each boy a glass of juice with their lunch, but Demetri asked her to sw
    13·1 answer
  • Which organisms are heterotrophs?
    7·2 answers
  • What is the male plants reproductive structure called?
    9·2 answers
  • What do you think prokaryotes envolver before eukaryotes?
    7·1 answer
  • Where does nad+ deliver electrons compared to fad in cellular respiration?
    5·1 answer
  • How does the operator region of DNA work to regulate gene expression?
    6·1 answer
  • Why are flowers important to plants?
    8·2 answers
  • DDT is a pesticide that has been used worldwide over the past 50 years. DDT is used to prevent insects from destroying crops and
    14·1 answer
  • Sally is pregnant and worried that she might be Rh incompatible with her
    15·1 answer
  • 1. Identify the three main gases in our atmosphere which trap some of the heat from the sun.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!