AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
Over our lifetime, our DNA can undergo changes or mutations that result in differences in the DNA sequence and may affect the proteins that are made. Mutations can occur as a natural consequence of errors in DNA replication or as a result of exposure to environmental factors such as smoking, sunlight or radiation.
Explanation:
B is the answer, it wants me to type more so hehehhe
Answer:
the distinguishable features of these creatures include moist, scaleless skin and cold-blooded. Amphibians absorb water and respiration occur through their skin.
B. Specialist
Let me know if you need any other help!