Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
An acronym for change would be preserve because that means keep
<span>Thymine is harder to make, but more stable. DNA needs to keep information safe for a long time, so it makes sense to use thymine. But RNA is made and used quickly, and small mistakes don’t matter as much, so the easier to make uracil does the job.</span>
This movement is called diffusion
The region on the neuron where action potentials are generated is called the trigger zone. It<span> is an area of the medulla oblongata that receives inputs from blood-borne drugs or hormones, and communicates with other structures in the vomiting center to initiate vomiting.</span>
