Explanation:
you will end up with 24 chromosomes instead of the standard 23 and have down syndrome
Answer:
B. As snow and ice melt, the underlying surfaces absorb heat from solar radiation
Explanation:
Which of these is part of a feedback loop that results in a cooling effect on Earth as snow and ice melt, the underlying surfaces absorb heat from solar
Answer:
Adolescent
Explanation:
Globally about 50% of mental health issues and conditions start at the age of 14. Most of them are not detected and treated. One of the most common causes of mental issues is depression among adolescents. The common factors leading to mental distress among adolescents include exploration of sexual identity, exposure to different social behaviours, money and access to technology.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
