1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katyanochek1 [597]
2 years ago
8

Identify a situation where none of the legal protection mechanisms discussed would prove useful and explain why they would not b

e useful.
Law
1 answer:
Ivan2 years ago
5 0

Legal protection mechanisms would be prove useful in product invention.

<h3>What is the product invention about?</h3>

Note that any product invention is one that often needs Legal protection mechanisms if one do not want your intellectual property to be stolen.

Note that the use of Legal protection mechanisms for one's product will make it so that it cannot be easily reverse-engineered.

Learn more about  legal protection from

brainly.com/question/14479936

#SPJ12

You might be interested in
Chủ nghĩa Mác-Lênin khẳng định: "Một cuộc cách mạng chỉ có giá trị khi nào nó biết tự bảo vệ và bảo vệ tổ quốc XHCN là một tất y
3241004551 [841]
Hm i’m not sure, is this russian?
6 0
2 years ago
Some early police forces were organized by politicians. This era of the history of policing is known as the Political Era. What
Zigmanuir [339]

Answer:

Political Era major weakness of these forces was corruption.

Explanation:

3 0
3 years ago
How might we use criminological theory in our roles in law enforcement, the courts, or corrections?
ipn [44]

Answer:   Well, Im not in law school or college but Criminology is just like Psycology. Take a first-time killer for example, which after each murder (strangulation for example) puts the Lucifer pentagram on the body of each victim. The way the person was killed is the MMO. Motives, Means, and Opportunity. the way they killed the person, that will be their 'signature'. If a new victim comes up with the same signature and mmo, that will rank the murderer a serial killer. many people kill because they dislike the person, or are mentally ill. in the line of duty like fbi and homicide detective, they always try to understand exactly why the person did this. was it revenge? robbery gone wrong? copycat serial killer? (copycating is where you take a serial killer from the past and recreate their signature and mmo. if that serial killer isnt already dead or in prison, it might be thought that person has come back). all of this comes down to one word:

<h2>profiling </h2>

since criminology is just the basic study of criminals and people and to why they do things, it will always be used in law enforcement and first responders.

i hope this helped!

4 0
3 years ago
Read 2 more answers
The entire network of businesses that work together in production,
Varvara68 [4.7K]

Answer:

D.global marketplace

6 0
3 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
Other questions:
  • Janet, a twenty year old women, applied for a position driving a truck for Federal Trucking Inc. Janet, who is 5'4" tall and wei
    12·1 answer
  • Sixteen year old Carrie is baby sitting for her four year old niece Jill. Carrie leaves Jill alone in the living room and goes i
    9·1 answer
  • In the Katz vs United States case what is the constitutional issue involved in this case
    9·1 answer
  • Ben files a suit in a federal district court against Cathy. Cathy loses the suit, appeals to the U.S. Court of Appeals for the S
    6·1 answer
  • What are the characteristics of the “Gold Standard” of behavioral science, the experimental model
    12·1 answer
  • PLS ANSWER/HELP: Which element distinguishes routine activity theory from situational crime prevention?
    12·2 answers
  • Which section of the article highlights the fact that the Supreme Court had outlawed segregation
    8·1 answer
  • A local hardware store is selling a dented refrigerator with the typical warranty excluded. What should the hardware store put o
    5·1 answer
  • It would be inefficient to have a full election every time a decision is required by the government. So the US public elects off
    8·1 answer
  • The most important function of the FDIC is it-
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!