1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
2 years ago
14

Need answers for 10-12 please !

Biology
1 answer:
Mademuasel [1]2 years ago
3 0

Answer:

2

Explanation:

it's 10-12 take away 10 and all u have is 2

You might be interested in
Write a mini-essay about Balanced & Unbalanced Forces
vaieri [72.5K]

Answer:

Forces have a magnitude (strength) and a direction. Forces can be represented as arrows with the length of the arrow representing the magnitude of the force and the head of the arrow pointing in the direction of the force.  Using such arrows, the resulting force (net force) and direction can be determined.

Forces acting on an object can be balanced or unbalanced.

4 0
3 years ago
Read 2 more answers
How does the theory of evolution explain the similarities and differences among living organisms?
Luba_88 [7]

that they will change over time and adapt to new envirments
6 0
3 years ago
Name the plasma proteins?​
damaskus [11]

Plasma protein status. Albumin, globulins and fibrinogen are the major plasma proteins.

4 0
3 years ago
Read 2 more answers
AUUUAACUGUUCUGUCUAGAG
Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0
3 years ago
Amoebas are unicellular organisms, while human beings are multi-cellular and the most intelligent of organisms. However, both ar
Leni [432]
<span>.Though unicellular [amoebas] have all the necessary cell organelles and a well-defined nucleus, therefore fulfilling the characteristics of eukaryotes.</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Describe the relationship between science and technology, and give an example of how they are related.
    7·1 answer
  • What does a cell's surface area to volume ratio affect?
    8·1 answer
  • Which foods would not be appropriate as part of a pregame meal?​
    14·1 answer
  • What would happen to the nitrogen cycle if this step happen
    13·1 answer
  • Which nucleotide in RNA is different than in DNA?<br> OT<br> Ο Α<br> OU<br> OG
    14·1 answer
  • Can anyone help me please?
    7·2 answers
  • Recently, a human trachea ( a respiratory organ) was produced by using a patient's own stem cells. The benefit of using the pati
    6·1 answer
  • Describe the overall goal of photosynthesis and include the complete chemical reactions (in chemical form)
    10·1 answer
  • Summarize it!<br> Express the law of conservation of energy in a diagram. SC.7.P.11.3
    7·1 answer
  • The flat shaped cells found covering the skins are _________ in shape
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!