1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikklg [1K]
2 years ago
9

Need assistance with this Biology assignment questions 3 & 4.

Biology
1 answer:
Gre4nikov [31]2 years ago
6 0

Answer:

waww grapee strong grhdddhhf he d

You might be interested in
Gizmo Warm-up
Helen [10]

Answer: no

Explanation: some of the cells look the same but some don’t and this is basically saying that they are not all the same. There is like 4 different types of cells.

3 0
2 years ago
List three primary categories of freshwater use.
slamgirl [31]

Answer:

It can be used for washing hands washing cars and filling swimming pools.

Explanation:

5 0
3 years ago
3. What will likely happen to New York and Europe in the future?
Ksju [112]

Answer:

In my opinion Europe and New York would probably grow, depending on how many people join their population.

Explanation:

I say this because many people love Europe and New York that they visit many times and most people go over their to stay for good.

4 0
3 years ago
How do cells differentiate from each other? What sends a cell the message to become one kind of cell rather than another type?
tester [92]
Cell differentiation is a process by which stem cells give rise to different type of cells with different functions and located in different locations. it is is true that all cells in a particular organism have same composition of genetic material. however they perform different function because of the process of cell differentiation. cell differentiation results from expression of some genes inside the cell the dictate what type of cells should be synthesized.after gene expression proteins produced send the message to stem cells to indicate the type of cells to be manufactured.  
7 0
3 years ago
Read 2 more answers
List the two conclusions that morgan made about genes and chromosomes answer key
DIA [1.3K]
The following are the two conclusions that Morgan made about qualities and chromosomes: 
1: Each chromosome is really a gathering of connected qualities. 
2: Mendel's standard of autonomous combination still remains constant.
I hope the answer will help. Feel free to ask more questions in brainly.
4 0
3 years ago
Other questions:
  • Why are trans fats not considered safe
    13·2 answers
  • Do the protein polymers in our food have the same structure as the proteins polymers in our body
    5·1 answer
  • What does nicotine do to the body
    15·2 answers
  • In a population of beetles, about 1 in every 6 beetles is slightly smaller and lighter in color than the others. the small, ligh
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • At which stage would centromeres of sister chromatids Disjoin and chromatids separate?
    10·1 answer
  • What are the flowers in the picture​
    11·2 answers
  • Please help biology 20 points
    10·1 answer
  • Help please ! Thanks
    12·2 answers
  • One major criticism of globalization is that it can:
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!