Monoculture involves crop rotation as one of its elements.
Macrominerals and trace minerals.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
Proteins also have structural or mechanical functions, such as actin and myosin in muscle and the proteins in the cytoskeleton<span>, which form a system of scaffolding that maintains cell shape. Other proteins are important in cell signaling, immune responses, </span>cell adhesion<span>, and the cell cycle. hope that helped</span>
<span>Chlorophyll green pigment is responsible for the color of the epidermal cells of the zebrina. This is because the zebrina is a plant and plants, particularly the leaves are green from chlorophyll. Chlorophyll is found in cyanobacteria and the cytoplast.</span>
