1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crazy boy [7]
1 year ago
10

You look in the microscope and see sister chromatids moving to opposite sides of the cell. You conclude the cell is in:

Biology
1 answer:
Gnoma [55]1 year ago
6 0

Answer:

Anaphase is the right answer

Explanation:

You might be interested in
List the animals you think can survive when the sunlight is blocked​
svetlana [45]

Answer: c

Explanation:

6 0
3 years ago
Read 2 more answers
How does diploidy help to preserve genetic variation? see concept 23.4 (page 498)?
mario62 [17]
Monoploid organisms reproduce asexually since they need to transmit all of their genetic material to their offspring. Diploid organisms, have 2 copies of their genetic material that differ slightly in their genes. Since the progeny gets half of the DNA from each parent, we have that new combinations can emerge; for example, if the mother is AA for some allele and the father aa, their offspring will be Aa, a new genotype. This might have different implications (for example, the recessive gene for thalassemia also provides resistance to malaria). Finally, during meiosis, there is also an event called crossover that increases the genetic variation of the offspring.
3 0
3 years ago
Please help me ASAP!! (In image)
Molodets [167]

Answer: i would say the answer is D

Explanation: srry if i got it wrong

5 0
3 years ago
Read 2 more answers
Why are shell of marine snails heavier than garden snails?
const2013 [10]
They have to have a higher density than water to have the ability to stay on the sea floor. Otherwise they would just float to the surface of the water
6 0
3 years ago
Scientists studied reproduction in the New Zealand mud snail to answer the question, “Are there benefits to reproducing sexually
Kryger [21]
Snails are asexual they create their own baby's with themselves. they have both parts....thats all ik
7 0
3 years ago
Read 2 more answers
Other questions:
  • In an energy pyramid, which level has the least available energy?*
    12·2 answers
  • All fossil fuel power types share this disadvantage:
    14·2 answers
  • What is the vasa vasorum and what role does it play?
    6·1 answer
  • Please if you can, please help..
    7·1 answer
  • As part of an experiment on circadian rhythms, a laboratory rat’s brain has been lesioned. The animal is now falling asleep and
    10·1 answer
  • Which type of microscopy would you use to examine the physical structure of a virus?
    14·1 answer
  • 1. the sodium atom .....
    8·2 answers
  • Prior Knowledge Questions (Do these BEFORE using the G
    13·1 answer
  • Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
    14·1 answer
  • In developed countries which of the following is a positive effect of agricultural changes in the past century?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!