1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alla [95]
2 years ago
15

Which statement is best supported by the diagram?

Biology
1 answer:
soldi70 [24.7K]2 years ago
7 0

Answer:

Maximum potential energy is at point P.

You might be interested in
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
Amniocentesis is a process in which amniotic fluid is taken from the mother's womb to identify any genetic abnormalities in the
Zarrin [17]
<span>B)<span>The exact location of a particular disease-causing gene can be determined.

</span></span>
4 0
3 years ago
Read 2 more answers
Planet A has a tilt of five degrees. What seasonal changes would be expected on this planet?
andrey2020 [161]

Answer:

MRCORRECT has answered the question

Explanation:

Do to the fact that Earth's axis is tilted 23.5 degrees to the plane of the "ecliptic", which is the plane of the Earth's orbit around the Sun. Each planet's orbital plane is a little different from Earth's, and each planet has a different axial tilt. The fact that we are talking about 5 dgrees we are talking about Jupiter which there would be little to no change

8 0
3 years ago
I NEED HELP WITH THIS QUESTION
Margaret [11]

Answer:

Answer is A

Explanation:

It is rewarding the dog.

8 0
1 year ago
Read 2 more answers
What would be made in DNA replication using the following DNA strand – ACT GGA
Sergio039 [100]
The answer would be B.
8 0
3 years ago
Other questions:
  • Brenda and her friend are relaxing in a paddleboat, slowly working the paddles with their legs to move the boat. Which organelle
    10·2 answers
  • Which of the following is not a characteristic of all life?
    5·1 answer
  • Which act addresses abandoned hazardous waste sites with significant contamination?
    6·1 answer
  • What is true of systems in terms of their size and boundaries?
    6·1 answer
  • A friend tells you he is 30 miles from the fountain in the middle of the city. Write a short paragraph to explain why you can’t
    5·2 answers
  • Why would wearing sunscreen help prevent melanoma
    13·2 answers
  • Empty stomachs contract, causing both hunger pangs and the secretion of chemical messages that travel to the brain to serve as a
    5·1 answer
  • Which of the following promotes closure of the minivalves associated with lymph capillaries?
    13·1 answer
  • How many cells are made in a month?​
    9·2 answers
  • Explain Natural Selection
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!