1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lawyer [7]
2 years ago
8

A hypertonic solution has:

Biology
1 answer:
myrzilka [38]2 years ago
3 0
Option A I guesss. Not sure
You might be interested in
Witch step of cellular respiration will not take place in the absence of oxygen
Over [174]

The answer is; glycolysis

This process converts glucose molecule to pyruvate. It is an oxygen-independent pathway, unlike the Krebs cycle. Glycolysis occurs in the cell cytoplasm while the Krebs cycle (aerobic pathway) occurs in the mitochondria. In the presence of oxygen, the product of glycolysis, i.e pyruvate, is fed to the Krebs cycle.  If oxygen is unavailable the pyruvate is converted to lactate.


7 0
3 years ago
What is a reactant in the calvin cycle?
nekit [7.7K]
The light reactions use the reactant water from the equation and release the product oxygen.
4 0
3 years ago
Read 2 more answers
Here is an easy question with 20 points :))))
AysviL [449]

Answer:

heyyyyyy

Explanation:

nfxhuyhffgggvvuhgggg

I like it cur G

6 0
3 years ago
The materials of the crust have less mass than materials deeper in the earth.<br><br> True<br> False
mezya [45]

Answer:

True

Explanation:

The crust makes up less than 1% of earths mass.

5 0
2 years ago
PLEASE HELP ME I DONT UNDERSTAND
Bond [772]

Answer: Does the black sqaure represent disease? If so, emma is #1. As for the others i think i need more context

Explanation:

3 0
3 years ago
Other questions:
  • Which two factors come together to create psychological suspense
    10·2 answers
  • How long after a living thing dies is C14 useful for dating
    6·1 answer
  • Proteins such as hemoglobin are known as _____ proteins since binding of a molecule to one site alters the binding at other site
    10·1 answer
  • Why is a toxic chemical spill on land potentially harmful to animals that live in the ocean?
    8·2 answers
  • Which one of the following statements accurately describes a characteristic of red blood cells?
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How is cross-fertilization advantageous over asexual reproduction?
    6·1 answer
  • A scientist performs an experiment to see how plants respond to acid rain. He places the water plants in water of varying pH mea
    9·1 answer
  • Here is a picture lolz
    5·2 answers
  • Why is meiosis important for organisms?
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!