1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harlamova29_29 [7]
2 years ago
11

How does water enter the atmosphere? a. liquid water evaporates from lakes when heated by the sun. b. frozen water sublimates fr

om ice and snow. c. liquid water is lost from tree leaves during evapotranspiration. d. all of the above. please select the best answer from the choices provided a b c d
Biology
1 answer:
pentagon [3]2 years ago
7 0

Answer:

<u>d</u>

Explanation:

Water enters the atmosphere by :

⇒ liquid water evaporates from lakes when heated by the Sun

⇒ frozen water sublimates from ice and snow

⇒ liquid water is lost from tree leaves during evapotranspiration

You might be interested in
If a polygons is an octagon then it has eight sides
Delicious77 [7]

Answer:

This is true.

Explanation:

An octagon is a type of polygon that has (8) sides.

7 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Which of the following organisms represents a list of nekton animals.
zhuklara [117]
I believe the correct answer is C. Nektons include bony fish and squid.
4 0
4 years ago
True or False. Animals vary tremendously in structure. Nevertheless, they can be categorized into a few basic body plans based o
NNADVOKAT [17]

Answer:

True

Explanation:

Animals can be categorized into 3 based on body symmetry

  • <em>Those without any body symmetry (asymmetrical)</em>
  • <em>Those with bilateral body symmetry (bilateria)</em>
  • <em>Those with radial body symmetry (Radiata)</em>

Animals can be categorized into 2 based on number of embryonic germ layer;

  • <em>Those with two layers - endoderm and ectoderm (diplobastic)</em>
  • <em>Those with three layers - mesoderm in addition to ectoderm and endoderm (triploblastic)</em>

Animals can be categorized based on presence/absence of body cavity or coelom;

  • <em>No body cavity - acoelomates</em>
  • <em>False body cavity - pseudocoelomates</em>
  • <em>True body cavity - coelomates</em>

Animals can be categorized into 2 based on characteristics of embryonic development;

  • <em>Deuterostomes</em>
  • <em>Protosomes</em>
5 0
3 years ago
What is the name for an organism’s genetic material?
IgorC [24]
It’s called the DNA
5 0
3 years ago
Read 2 more answers
Other questions:
  • Has three stages - evaporation, condensation, and precipitation
    15·1 answer
  • Ugh i need more help
    13·2 answers
  • Explain the characteristics scientists use when observing organisms and placing them in the six kingdoms .
    11·2 answers
  • While cleaning a saltwater aquarium, students placed a family of fiddler crabs from the saltwater aquarium into a container of d
    5·2 answers
  • The side of photosynthesis
    14·1 answer
  • Altering patterns of gene expression in prokaryotes would most likely serve an organism's survival by _____.
    15·1 answer
  • Which consequence of global warming is described as having an increase in growing season, changes in migration, and loss of spec
    9·2 answers
  • What is the simplest type of passive transport
    8·1 answer
  • How do nutrients from food enter the circulatory system?
    8·1 answer
  • C. In which situation is the paramecium in danger of swelling up and bursting?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!