All categories

2 years ago

Endorsements by celebrities

Biology

1 answer:

Sergio [31]2 years ago

6 0

Similar results in multiple tests of the claim is an example of a scientific claim.

<h3>What is Scientific claim?</h3>

These are referred to statements which are made based on experimental results in the field of science.

The results gotten must also be similar to a large extent when performed by others in order to ascertain its validity.

Read more about Scientific claim here brainly.com/question/717323

#SPJ1

The full question is:

Which factor is found in a scientific claim?

You might be interested in

Viruses _____.

Montano1993 [528]

viruses are tiny bundles of genetic material which is carried in a viral coat.

<u>Explanation:</u>

The virus is generally a parasite that needs a host to become active and to reproduce. It cannot reproduce without the host.
The tiny bundle consists of genetic material and protein. The virus consists of capsid and nucleic acid. This capsid is said to be the protein coat.
This capsid consists of either RNA or DNA. virus replicate themself within the host body by using its genetic material along with the mechanism of the host.
Thus after replicating the virus need to get out of host cell, It is performed by two types budding or lysis( bursting the host cell ).

6 0

3 years ago

A person infected with human immunodeficiency virus (HIV) may not have any symptoms for a period of time. During this period the

Reika [66]

Answer:

Explanation:

4 0

3 years ago

Which of the following is part of the central nervous system?

Amanda [17]

D. All of the above

7 0

3 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

2. What are individual characteristics? Give an example of an individual characteristic?

kvv77 [185]

Answer:

Individual Characteristics are properties of physical evidence that can be attributed to a common source with a high degree of certainty. Examples of individual evidence include anything that contains nuclear DNA, toolmarks, and fingerprints.

Explanation:

4 0

3 years ago

Read 2 more answers