1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weeeeeb [17]
3 years ago
10

What is polarity? Describe the polarity of water.

Biology
1 answer:
malfutka [58]3 years ago
3 0
Water, which not only dissolves many compounds but also dissolves more substances than any other liquid, is considered the universal solvent. A polar molecule with partially-positive and negative charges, it readily dissolves ions and polar molecules. Hopefully this helped :D
You might be interested in
In which step of protein synthesis does the rRNA make protein?
Inessa [10]

Answer:

Translation is the second part of the central dogma of molecular biology: RNA → Protein. It is the process in which the genetic code in mRNA is read to make a protein. Translation is illustrated in the diagram below. After mRNA leaves the nucleus, it moves to a ribosome, which consists of rRNA and proteins.

Explanation:

Within the ribosome, the rRNA molecules direct the catalytic steps of protein synthesis — the stitching together of amino acids to make a protein molecule. In fact, rRNA is sometimes called a ribozyme or catalytic RNA to reflect this function.

8 0
3 years ago
Which of these can occur long after a volcanic eruption?
notsponge [240]
The answer is D. A Lahar
4 0
3 years ago
Read 2 more answers
According to the article, why might Indians rationally choose not to eat cow even during times of starvation?
ludmilkaskok [199]

Answer:

Many Indians believe in Hinduism, which preaches that cows are sacred. They might choose not to eat cow even during times of starvation because they are afraid of the consequences that come in the afterlife. Because cows are sacred, Indians believe that eating them might incur a net negative benefit when considering the afterlife.

Explanation:

No article was provided and I don't particularly know much about the subject so this is my best guess. Please adapt this answer accordingly.

7 0
3 years ago
In California, the cowbird has been responsible for the disappearance of at least three kinds of songbirds- the willow flycatche
arsen [322]

Answer:sorry I don't know

Explanation:

5 0
3 years ago
Read 2 more answers
The photograph shows one way individuals work together in groups. What
notka56 [123]
I think the answer would be. B
4 0
2 years ago
Other questions:
  • Using complete sentences, compare and contrast the terms living and biotic. In your response, illustrate using examples and appr
    6·2 answers
  • PLEASE HELP!! Identify the event that indicates that evolution has occurred. A. A white-eyed fly is born into a population of br
    11·1 answer
  • The large commisure that connects the cerebral hemisphere is
    15·1 answer
  • Which of the following will protect against flooding
    15·1 answer
  • Describe Two types of drugs and the negative impact the abuse of of these drugs can have on a person health
    8·2 answers
  • What components of the eukaryotic cell were visible in the onion root tip? Which components were not? Why do you think some comp
    10·1 answer
  • What do dogs do when their body temperature rises?
    8·1 answer
  • Describe how acid precipitation negatively affects soil, plants, lakes and streams, and aquatic organisms?
    5·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • The dimmer star in a two-star system passes in front of the brighter star. Which phenomenon does this describe?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!