1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
2 years ago
12

Imagine that these animals lived in a costal habitat, Due to global warming, sea level rise and the area was flooded. Which grou

p would MOST LIKELY be best adapted for this change in habitat?
Biology
2 answers:
baherus [9]2 years ago
6 0

Animals that can live in water will best adapted for this change in habitat.

<h3>Which group would be best adapted for this change in habitat?</h3>

That group would most likely be best adapted for this change in habitat which can survive in both on land and water because the area has now water so that group which can swim and live in water will survive while the rest will die or extinct from that area.

So we can conclude that animals that can live in water will best adapted for this change in habitat.

Learn more about habitat here: brainly.com/question/23780904

#SPJ1

vredina [299]2 years ago
3 0

If the area is said to be flooded due to global warming, the group that would most likely adapt to this change are the animals in group E.

<h3>What are the group E animals?</h3>

These are the groups of animals that are able to seek shelter in such periods as floods by rising to the top of the water and staying afloat.

These types of animals are amphibians as well as reptiles. They can be able to swim on this water for a long time.

Read more on global warming here:

brainly.com/question/3553382

#SPJ1

<h3>Complete question</h3>

Imagine that these animals lived in a costal habitat, Due to global warming, sea level rise and the area was flooded. Which group would MOST LIKELY be best adapted for this change in habitat?

Group a.

Group b

Group C

Group D

Group E.

You might be interested in
D - Telophase
Eddi Din [679]

Answer:

A-B-C-D

Explanation:

PROPHASE; 1. chromosomes become thicker

2. nuclear membrane disintegrates

3. centrosome divide to form centrioles

4. centrioles move to the opposite polls of the cell

METAPHASE; 1. chromosomes get arranged at the equator

2. centrioles produce spindle fibre that attach to the middle of the chromosomes

ANAPHASE; 1. shortest stage of mitosis

2. spindles will pull apart each chromosomes to form chromatids

TELLOPHASE; 1.  each chromatid moves to opposite polls of the cell

2. nuclear membrane appears around both of them

3. the centrioles sill stop producing spindles

4. centrosomes will then form again

cytokinesis then divides by the cleavage furrow to form the two daughter cells

7 0
3 years ago
Where cerebrospinal fluid leaves brain to be recycled?
vovangra [49]
<span>The fluid flows through the interventricular foramen into the third ventricle, is augmented by fluid formed by the choroid plexus of this ventricle, and passes through the cerebral aqueduct to the fourth ventricle, which also possesses a choroid plexus. The CSF from all theses sources , as well as any formed in the central canal of the spinal cord, escapes from the fourth ventricle into the subarachnoid space through the median aperture and lateral aperture.</span>
8 0
3 years ago
When our bodies overcome the offensive tactics of a particular microorganism, this is referred to as? a) therapy. b) colonizatio
ikadub [295]

When our bodies overcome the offensive tactics of a particular microorganism, this is referred to as Resistance.

The body's defense against infection is provided by the immune system, a complex network of organs, cells, and proteins that also safeguards the body's own cells.

Our immune system remembers every germ (microbe) that the immune system has ever eliminated, allowing it to promptly identify and eliminate the microbe if it re-enters the body.

The body contains a number of additional mechanisms in addition to the immune system for defending itself against microorganisms, such as:

The skin acts as a waterproof barrier and secretes oil that has antibacterial qualities.

Lungs: Phlegm (mucous) in the lungs collects foreign particles, and tiny hairs (cilia) waft the phlegm upward so that it can be expelled through coughing.

digestive tract: Most germs can be killed by stomach acid and the mucous lining, which contains antibodies.

Added defenses include the anti-bacterial enzymes found in body fluids like skin oil, saliva, and tears, which can lower the chance of infection. Constant bowel and urinary tract flushing are also beneficial.

Learn more about the immune system here:

brainly.com/question/27591396

#SPJ4

7 0
1 year ago
Why is Acinetobacter bamannii bacteria dangerous.
shepuryov [24]
Because it can cause serious infections in the lungs, blood and our brains...It may also cause urinary tract and infections in wounds.
8 0
3 years ago
Read 2 more answers
An essay about clubfoot
gizmo_the_mogwai [7]

Answer:

use this- Clubfoot is a deformity in which an infant's foot is turned inward, often so severely that the bottom of the foot faces sideways or even upward. Approximately one infant in every 1,000 live births will have clubfoot, making it one of the more common congenital (present at birth) foot deformities.

Explanation:

6 0
3 years ago
Other questions:
  • Why doesn’t the sun die if it’s a star???
    13·1 answer
  • A toy car accelerates 1.25 m/s2 when a child pushes it with a force of 0.1 newtons. What is the mass of
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which structures are found in every living cell​
    15·2 answers
  • Which of these is a possible risk associated with stem cell therapy? A) The host’s body could reject the transplanted stem cells
    14·2 answers
  • The respiratory system allows for gas exchange to happen in the lungs. How does the respiratory system affect the cardiovascular
    8·1 answer
  • The process of becoming physiologically adjusted to a high elevation is called _____.
    6·1 answer
  • WILL MARK BRAINLIEZT.
    10·1 answer
  • Human genetic material is represented in the diagram<br> below.
    7·1 answer
  • Which biomes have the most fertile soil and can sustain a very diverse ecosystem?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!