1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlabodo [156]
2 years ago
12

Imagine that these animals lived in a costal habitat, Due to global warming, sea level rise and the area was flooded. Which grou

p would MOST LIKELY be best adapted for this change in habitat?
Biology
2 answers:
baherus [9]2 years ago
6 0

Animals that can live in water will best adapted for this change in habitat.

<h3>Which group would be best adapted for this change in habitat?</h3>

That group would most likely be best adapted for this change in habitat which can survive in both on land and water because the area has now water so that group which can swim and live in water will survive while the rest will die or extinct from that area.

So we can conclude that animals that can live in water will best adapted for this change in habitat.

Learn more about habitat here: brainly.com/question/23780904

#SPJ1

vredina [299]2 years ago
3 0

If the area is said to be flooded due to global warming, the group that would most likely adapt to this change are the animals in group E.

<h3>What are the group E animals?</h3>

These are the groups of animals that are able to seek shelter in such periods as floods by rising to the top of the water and staying afloat.

These types of animals are amphibians as well as reptiles. They can be able to swim on this water for a long time.

Read more on global warming here:

brainly.com/question/3553382

#SPJ1

<h3>Complete question</h3>

Imagine that these animals lived in a costal habitat, Due to global warming, sea level rise and the area was flooded. Which group would MOST LIKELY be best adapted for this change in habitat?

Group a.

Group b

Group C

Group D

Group E.

You might be interested in
What role do all antigen-presenting cells (APCs) play?
lbvjy [14]

Answer:

b). activation of T cells

Explanation:

An APC (antigen-presenting cell) can be described as an immune cell, which detects, uptakes, and informs the acquired immune response when an infection takes place. B cells, macrophages, and dendritic cells are antigen-presenting cells.

These cells play an important role in activation of T cells. T cells are unable to recognize soluble or free antigens and can only recognize antigens processed and presented by carrier molecules, such as MHC molecules.

Presence of MHCII molecules is a defining feature of APCs that process and present antigens to T cells. Hence, all antigen-presenting cells help in activation of T cells.  

Thus, the correct answer is option (b).

4 0
3 years ago
Gene flow _____.
nikitadnepr [17]

Answer: The correct answer for the blank is-

evens out genetic differences between populations

Gene flow or migration of gene can be described as a process of transfer of genetic variation from one population into another population. This process leads to change in the frequency of a gene variant ( that is called allele) in a particular population and it reduces the genetic differences between population.

If the process of gene glow is high, then the two population will be considered equivalent in genetic diversity.

Thus, Gene flow evens out genetic differences between populations

8 0
3 years ago
Read 2 more answers
What happens at s stage
Law Incorporation [45]

replication of dna                                                                                                         i need 20 characters

8 0
3 years ago
Read 2 more answers
Complete the sentence choosing from the following words:
denis23 [38]

Answer:

1. Soluble

2. Catalyze

3. Denatured

Explanation:

1. We eat in order to obtain energy. However, this food is often in a complex state and needs to be broken down into its simplest form. The process of digestion ensures this occurs in living organisms. Digestion is the process of breaking down large food molecules into a much more simpler molecule that can be passed on to the blood stream for absorption by cells. These simpler molecules must be SOLUBLE in water for them to be transported into each cell via the bloodstream.

2. The breaking down of food molecules described above is facilitated by certain proteinous chemical agents called ENZYMES. Enzymes are biological catalysts i.e. they help speeden up the rate of biochemical reactions in living systems. In the case of digestion, specific enzymes chemically acts on specific food molecules. For example, amylase acts on carbohydrates, protease acts on proteins etc.

3. As stated above that enzymes are proteinous, it means they possess the characteristics of proteins. One of those characteristics is the ability to get denatured by increase in temperature. High temperature causes an enzyme to lose its specific 3D shape, affecting its functionality. Hence, the enzyme is said to be DENATURED.

8 0
3 years ago
A broad, ramp-like accumulation of sediment found downstream from the end moraine of a glacier is _____.
Mice21 [21]

An outwash plain

A broad, ramp-like accumulation of sediment found downstream from the end moraine of a glacier is an outwash plain.  

An outwash plain is a plain that develops when glacial sediments are being accumulated by melt water out wash at the end moraine of a glacier. Outwash plains that are composed of outwash deposits have a flat feature, and contain layers of sand and other residues. Plains that have sandy soils are usually utilized for specialized farming. An example is the potato production in Montcalm County.



4 0
3 years ago
Read 2 more answers
Other questions:
  • A class of chemical called a neurotransmitter is important in the transmission of nerve impulses. Neurotransmitters are packaged
    14·2 answers
  • 705 over 224 divide by 224 over 224
    8·1 answer
  • List all eight blood types.
    5·1 answer
  • Of the following, which is the most inclusive level of organization in nature?
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Air pollution is a<br> __________ to survival
    15·1 answer
  • Percentages of Nucleotide Differences in Chloroplast Genomes
    5·1 answer
  • Photosynthesis needs light. Complete the balanced symbol equation for photosynthesis. 6CO2 + ______________ --&gt;______________
    15·2 answers
  • How do other organisms benefit from other biotic and abiotic things in tropical rainforest?
    8·2 answers
  • A plant which loses its leaves in winter is known as which of the following?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!