1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AveGali [126]
2 years ago
15

The muscular system also depends on the __________ __________ system to provide a place for muscles to be attached in order for

muscles to provide the necessary force for movement.
Biology
1 answer:
kotegsom [21]2 years ago
3 0
Skeletal system.

Without a proper skeleton, we would not have enough rigidity to properly move. We'd be an awkward pile of skin, muscle & bodily fluids.

Hope that helps!
You might be interested in
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
2 years ago
Which of the following goals is the U. S. Integrated Ocean Observing System (IOOS) not intended to address? a. Increase understa
kenny6666 [7]

The following goal the U. S. Integrated Ocean Observing System (IOOS) is not intended to address is to promote ocean ownership.

<h3>What is the Integrated Ocean Observing System?</h3>

The United States' Integrated Ocean Observing System, is a network of people and technology.

It collaborates to collect and transmit data on our coastal waters, Great Lakes, and seas.

Some of its work is gathering data in the ocean, while others are on land or in space.

Thus, the correct option is C, which promotes ocean ownership.

Learn more about Ocean Observing System, here:

brainly.com/question/1565876

8 0
2 years ago
In human beings, the statistical probability of getting either a male or female child is 50:50. Give a suitable explanation.​
suter [353]

Answer:

There is 50 chance because there are two chromosomes that are same and two which are difeerent . XX MEANs girl XY means boys .

3 0
2 years ago
Read 2 more answers
Why did bear island provide a great opportunity to decipher entire food chains?
Sergio [31]

Answer:

Due to the presence of limited number of species.

Explanation:

Bear island provide a great opportunity to decipher entire food chains because this island has many animals species which interact with each other or depend on one another due to the presence of less animals for feeding purpose. This island is isolated from the rest of the world so it provide a great opportunity to study the entire food chains that are present at that island. There is less number of species so knowing about their feeding choices is easier for the ecologists.

8 0
3 years ago
Person #5 in generation II is a _________ with _________ genotype.
sammy [17]

Answer: i dont understand it....

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • The periodic table is organized by
    13·2 answers
  • Which type of skeletons do invertebrates such as crabs have?
    6·1 answer
  • Which functional area of monique's cerebral cortex is most likely to be impacted by the tumor?
    9·1 answer
  • Which type of wetlands are shrub-filled, watery, coastal, freshwater bogs? a. fens b. marshes c. pocosins d. riparians
    15·1 answer
  • Dust in homes often clings to furnishings due to electrostatic interactions. Describe how you think tiny dust particularly acqui
    11·2 answers
  • Why is cells important?
    15·1 answer
  • How did ichthyosaurus survive?
    13·1 answer
  • do decomposers belong on the energy pyramid? if not then why do the NOT belong on the energy pyramid?
    14·1 answer
  • Smog , illegal dumping , excessive lights , and loud , sustained noise are examples of
    15·1 answer
  • In rabbits, the allele for a spotted colored coat is dominant over the allele for a solid-colored coat. A spotted rabbit was cro
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!