1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vilka [71]
2 years ago
6

A commensal bacterium Group of answer choices does not receive any benefit from its host. is beneficial to its host. may also be

an opportunistic pathogen. does not infect its host. is beneficial to, and does not infect, its host.
Biology
1 answer:
erastova [34]2 years ago
4 0

A commensal bacterium does not infect its host, which is option D. Details about commensalism can be found below.

<h3>What is commensalism?</h3>

Commensalism is a kind of relationship that involves the sharing of the same environment by two organisms where one species benefits and the other is unaffected.

For example, barnacles on whales is a commensalistic relationship.

According to this question, a commensal bacterium will not affect or harm it's host by infect it neither will it benefit its host.

Learn more about commensalism at: brainly.com/question/14224704

#SPJ1

You might be interested in
Help please !! I really don’t understand this much☹️
morpeh [17]
Ok, so I wrote these out just to make it a little bit easier for you to understand what I am about to explain.

So for the first one you have two different traits that can be inherited- having freckles or having no freckles, F and f respectively. The dominant trait (or having freckles) is shown by the capital F, and is almost always expressed over the recessive trait, or the lowercase f. So, for example, if you have a genotype of Ff, the trait having freckles will show up instead of not having freckles. The only way that you could have the trait of no freckles show up is if there are two recessive alleles for having no freckles, or ff. In this case, you have two parents who are both heterozygous for the trait of having freckles, so in other words the mother has Ff and the father has Ff. Each parent passes down one allele to the offspring, so since you are breeding Ff and Ff, you should result in having the possible genotypes of FF, Ff, Ff, and ff. This means that there is a 25% chance that the offspring will be homozygous for having freckles, a 50% chance that the offspring will be heterozygous for having freckles and a 25% chance that they would be homozygous for having no freckles, or a 1:2:1 ratio.

Incomplete dominance is a little bit different that just a normal monohybrid cross. Instead of just the dominant gene showing up in a heterozygous genotype, both traits show up. So like the question says, if a homozygous red flower plant was crossed with a homozygous white flower plant, their offspring would not just be white or red, they would be pink because it is a mixture of white and red. So then if you crossed the heterozygous, or Rr plants, the result would be a 25% chance of getting a homozygous RR red plant, a 50% chance of getting a pink Rr plant, and a 25% chance of getting a white rr plant, or another 1:2:1 ratio.

Sorry for the wordy answer, but hopefully this helps you understand this a little better :)

4 0
3 years ago
Large blue whales that are up to 30 meters long live primarily on ________ that is/are only about 6 cm long.
zalisa [80]

Large blue whales that are up to 30 meters long live primarily on krill that is/are only about 6 cm long.

Blue whales belong to the class of mammals. They are the largest animals on the Earth. They live in marine habitat. They can be more than 100 feet long. The weight of a single whale can be equal to 30 elephants. And they can live for as long as 80-90 years.

Krill are small animals belonging to the class of crustaceans. They are present in oceans. Krill are actually zooplanktons. They are majorly the food of whales. Krill are filter-feeders.

To know more about blue whales, here

brainly.com/question/14803609

#SPJ4

7 0
2 years ago
What is the main source of energy for most life on earth? __
hodyreva [135]

Answer:

Sun

Explanation:

The main source of energy of energy for most organisms and the ecosystems. For example, producers, such as flowers and trees, use sunlight to go through photosynthesis.

6 0
2 years ago
What is the velocity of a wave
r-ruslan [8.4K]

Answer:

go help me on my 3 question please

Wave velocity in common usage refers to speed, although, properly, velocity implies both speed and direction. The velocity of a wave is equal to the product of its wavelength and frequency (number of vibrations per second) and is independent of its intensity.

Explanation:

8 0
3 years ago
Read 2 more answers
What types of local winds would you experiemce if you were standing in a valley at night
Neporo4naja [7]
Hey there,

Your question states: <span>What types of local winds would you experience if you were standing in a valley at night?

</span><span>The type of local winds would you experience if you were standing in a valley at night would be like a </span>\boxed{valley \ breeze}. Based on my research, when attending the valley of any sort, you would not really see like 10 MPH winds, there winds are not powerful at all. They are little breeze that feel good. That it why your answer is Breeze :)

~Jurgen
4 0
3 years ago
Other questions:
  • Imagine a population of Galápagos finches that vary for bill size. If the population mean is near the optimum size for eating th
    7·1 answer
  • This reaction is known as aerobic respiration. Explain why it is described as "aerobic"
    7·2 answers
  • I don't usually ask questions for school, I'm just curious. Well, if you look up 'savant syndrome', you'll understand this bette
    11·1 answer
  • What appropriate percentages of land have been used for housing and pasture areas?
    11·1 answer
  • Que es el sistema nervioso
    6·1 answer
  • A/an ___ is a type of research that involves observation and collecting data but does not include a control.
    7·1 answer
  • Identify five changes in medcial care over the past years that have affected the profession of medical assisting.
    15·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Many types of scientific equipment are used to perform different functions in the science lab. Which of the following combinatio
    14·1 answer
  • HELP HELP HELP HELPPPPPPPP
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!