1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GalinKa [24]
4 years ago
9

A spontaneously aborted human embryo is characterized with respect to karyotype, and it is found to be normal except that it con

tains only one chromosome number two. This is an example of what type of aneuploidy?
Biology
1 answer:
qaws [65]4 years ago
7 0

Answer:

monosomy or loss of a single chromosome

Explanation:

  • The presence of a given number of chromosomes in a cell that differs from the normal number of chromosomes defined for an organism is termed as aneuploidy.
  • There can be either an extra chromosome present or a chromosome that can be missing thus leading to either an increase or decrease in the number of total chromosomes in the organism.
  • If there is a loss of a single chromosome in the cell then this type of aneuploidy is termed as monosomy.
  • In a normal individual if two copies of one chromosome are present then monosomy would result only in the presence of a single chromosome.
  • This type of condition can lead to different genetic defect and disorders , one such example is turner syndrome.
  • Therefore, in the spontaneously aborted embryo, the presence of only one chromosome number two is a type of monosomy.
You might be interested in
What is considered to be the “missing Link” in a giraffes evolution?
puteri [66]

Answer:

giraffes evolves from miocene

7 0
3 years ago
Which of the following is an example of symbiosis? a. barnacles living on a whale’s skin b. a tree obtaining nutrients from the
Yakvenalex [24]
I believe A. Barnacles living on a whale's skin is an example of a particular symbiotic relationship.
6 0
3 years ago
Read 2 more answers
HELP PLEASE WILL GIVE BRAINLY! <br><br> What is a complementary RNA strand to AGA?
Irina18 [472]

Answer:Problem Set 4 Answers

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), then the Np and N-OH fragments should be labeled with tritium.

d. Since the N-OH fragments were labeled with tritium, RNA synthesis must occur in a 5' to 3' direction.

6. In a missense mutation, the new nucleotide alters the codon so as to produce an altered amino acid in the protein product.  With a nonsense mutation, the new nucleotide changes a codon that specified an amino acid to one of the stop codons (TAA, TAG, or TGA). Therefore, translation of the messenger RNA transcribed from this mutant gene will stop prematurely.

Explanation:

5 0
3 years ago
Reproductive isolation is not an accurate term to describe populations of a species that
Ainat [17]
Your answer is D lives in the same region as others closely related species. Because it wouldn't be C cause that's not isolation it would be B cause there not plants and its not A because it is reproductive but its not isolation.
6 0
3 years ago
What are the reactants in photosynthesis?
Lerok [7]

Answer:

light energy, water, carbon dioxide and chlorophyll

4 0
3 years ago
Read 2 more answers
Other questions:
  • What is equilibrium?
    9·1 answer
  • Which is true for both photosynthesis and cellular respiration?
    13·1 answer
  • What animal did a snake come from
    9·2 answers
  • Material in food chains
    7·1 answer
  • Which of the following explains why using locally-produced resources (as opposed to those produced a great distance away) can be
    12·2 answers
  • During the process of cellular respiration, energy is realeased from what<br>​
    14·1 answer
  • What is the basic form of matter which cannot be broken down any further
    10·1 answer
  • If you dissolved sugar in a liter of water, placed some of this solution in a permeable plastic bag and placed the bag in a beak
    11·1 answer
  • Pain in the epigastric region what organs could be involved
    6·1 answer
  • The two waves in the diagram are occupying the same place at the same time
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!